new resistance genes associated with disease resistance in soybeans

专利摘要:
The present invention relates to methods and compositions for identifying, selecting and / or producing a disease resistant soybean plant or germplasm using markers, genes and chromosomal ranges derived from Glycine tomentella PI441001, PI441008, PI446958, PI583970 or PI483224. Also provided is a soybean germ or plasma that has been identified, selected and / or produced by any of the methods of the present invention. Disease-resistant soybean seeds, plants and germ plasmas are also provided.
公开号:BR112020010066A2
申请号:R112020010066-8
申请日:2018-11-16
公开日:2020-11-03
发明作者:Qingli Liu；Thomas Joseph Curley, Jr.；Becky Welsh BREITINGER；John Luther Dawson；John Daniel Hipskind；Robert Arthur DIETRICH；Andrew David Farmer；Xiaoping Tan
申请人:Syngenta Participations Ag；
IPC主号:

专利说明:

[0001] [0001] The present invention relates to compositions and methods for identifying, selecting and producing improved disease resistant plants and / or pathogens using new resistance genes. DECLARATION RELATING TO THE ELECTRONIC SUBMISSION OF A SEQUENCE LISTING
[0002] [0002] A List of Strings in ASCII text format, submitted under 37 C.F.R. $ 1,821, entitled “81492-W0-L-ORG- NAT-1-SequenceList ST25", 17.1 MB bytes in size, generated on November 15, 2018 and deposited via EFS-Web, is provided instead of a This List of Strings is hereby incorporated by reference in the specification for its disclosures. BACKGROUND
[0003] [0003] Plant pathogens are known to cause considerable damage to important crops, resulting in significant agricultural losses with far-reaching consequences for the food supply and other industries based on plant materials. As such, there is an age-old need to reduce the incidence and / or impact of agricultural pathogens on crop production.
[0004] [0004] Various pathogens have been linked to damage to soybeans, which, individually and collectively, have the potential to cause significant yield losses in the United States and around the world. Exemplary pathogens include, but are not limited to fungi (eg, Phytophthora genus and Asian soybean rust Phakopsora pahyrhizi), nematodes (eg, Meloidogyne genus, particularly, Meloidogyne javanica) and soybean stem cancer. Given the significant threat to global food sources that these pathogens present as well as the time and costs associated with treating soy crops to prevent loss of yield, new methods are needed to produce pathogen resistant soy cultivars. New resistance genes (here, "R Genes") are needed that can be introduced into commercial soy plants to control soy pathogens. SUMMARY OF THE INVENTION
[0005] [0005] This summary lists several modalities of the subject currently revealed and, in many cases, lists variations and permutations of these modalities.
[0006] [0006] Compositions and methods for identifying, selecting and producing Glycine plants (including wild Glycines (eg Glycine tomentella) and strains of Glycine max) with enhanced disease resistance are provided. Disease-resistant plants and germinating soybean plasmas are also provided. In some embodiments, methods for producing a disease-resistant soy plant are provided.
[0007] [0007] In one aspect of the invention, a DNA construct is provided that comprises a promoter that functions in plant cells operatively linked to a new resistance gene ("here Gene R). In yet another aspect of the invention, a plant is provided transgenic that contains the DNA construct, in which the transgenic plant is resistant to soybean pathogens, particularly Asian Soybean Rust.
[0008] [0008] In another aspect of the invention, it is a method of preparing a fertile transgenic plant comprising providing a plant expression cassette comprising a Gene R and contacting recipient plant cells with the plant expression cassette under conditions that allow absorption of the plant expression cassette by recipient cells; and selecting the recipient plant cells that contain the plant expression cassette; and regenerating plants from selected recipient plant cells; and identifying a fertile transgenic plant that is resistant to soybean pathogens, particularly Asian Soybean Rust.
[0009] [0009] In another aspect of the invention, a fertile transgenic plant is provided which comprises a plant expression cassette comprising a Gene R and in which the plant is resistant to soybean pathogens, particularly Asian Soybean Rust.
[0010] [0010] In another aspect of the invention, a method is provided for controlling FAS in a field comprising the step of planting the seed of a plant comprising an R gene of the invention.
[0011] [0011] Thus, an objective of the subject currently disclosed is to provide methods to confer resistance to pathogens to germinating plasma or non-resistant soybean plant lines.
[0012] [0012] In addition, the subject currently disclosed provides new strains of Glycine max comprising in its genome an R gene that is derived from Glycine tomentella and provide additional resistance to Asian soybean rust (here, "FAS ') in the referred new strain of Glycine max. Soybean plants and / or germ plasmas identified, produced or selected by the methods of this invention are also provided, as well as any progeny and / or seeds derived from a soya plant or germinative plasma identified, produced or selected by these methods.
[0013] [0013] Still as an additional aspect, the invention encompasses transgenic plants comprising a plant cell, plant part, nucleotide sequence, expression cassette, vector and / or R genes of the invention.
[0014] [0014] As an additional aspect are seeds that produce the transgenic plants of the invention and seeds produced by the transgenic plants of the invention.
[0015] [0015] Collected products derived from the transgenic plants of the invention are also provided, in which the collected product optionally comprises a nucleotide sequence, expression cassette, vector and / or R gene of the invention. Processed products derived from the collected products of the invention are additionally provided, wherein the collected product optionally comprises a nucleotide sequence, expression cassette, vector and / or R gene of the invention.
[0016] [0016] In addition, the invention provides, as an additional aspect, a method for producing a transgenic plant with increased resistance to a soybean pathogen. In modalities, the method comprises introducing into a plant a polynucleotide, expression cassette or vector of the invention, in which the R gene is expressed in the plant, thereby producing a transgenic plant with increased resistance to a soybean pathogen. Optionally, the introduction step comprises: (i) transforming a plant cell with the polynucleotide, expression cassette or vector and regenerating a transgenic plant; or (ii) crossing a first plant comprising the polynucleotide, expression cassette or vector with a second plant. In modalities, the method also includes the production of a seed from the transgenic plant. In modalities, the method also comprises obtaining a progeny plant from the transgenic plant, in which the progeny plant comprises the polynucleotide, the expression cassette or the vector, expresses the R gene and has increased resistance to a soybean pathogen.
[0017] [0017] As yet another aspect, the invention provides a method for producing a transgenic plant with increased resistance to a soybean pathogen (e.g., Asian Soybean Rust), the method comprising: (a) planting a seed "comprising a polynucleotide , expression cassette or vector of the invention, and (b) growth of a transgenic plant from seed, where the transgenic plant comprises the polynucleotide, expression cassette or vector and produces the R gene and has increased resistance to a pathogen of In modalities, the method additionally comprises: (c) harvesting a seed from the transgenic plant of (b), in which the collected seed comprises the polynucleotide, expression cassette, vector and / or the R gene.
[0018] [0018] Even more, as another aspect, the invention provides a method for producing a seed. In embodiments, the method comprises: (a) providing a transgenic plant that comprises a polynucleotide, expression cassette or vector of the invention; and (b) harvesting a seed from the transgenic plant of (a) in which the collected seed comprises the polynucleotide, expression cassette or vector and / or an R gene of the invention.
[0019] [0019] The invention also contemplates a method of producing a hybrid plant seed. In representative embodiments, the method comprises: (a) crossing a first inbred plant, which is a transgenic plant comprising a polynucleotide, expression cassette or vector of the invention with a different inbred plant, which may or may not comprise a polynucleotide, expression cassette or vector of the invention; and (b) allowing a hybrid seed to form.
[0020] [0020] The invention is also directed to methods of using the polynucleotides of the invention, for example, in DNA constructs or expression cassettes or vectors for transformation and expression in organisms, including plants. The nucleotide or amino acid sequences can be native or synthetic sequences that have been designed for expression in an organism, such as a plant.
[0021] [0021] In embodiments, the invention provides a method of using a polynucleotide, expression cassette or vector of the invention to produce a transgenic seed, in which the transgenic seed grows to a transgenic plant with increased resistance to a soybean pathogen.
[0022] [0022] The previous and other objectives and aspects of the present invention are explained in detail in the figures and specification presented below. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] [0023] Figure 1. Determination of gqgRT-PCR of the fungal b-tubulin of the host differential panel.
[0024] [0024] Figure 2. Formula used to process the raw gRT-PCR readings.
[0025] [0025] Figure 3. Biomass “fungal normalized with different constructs using the known resistance gene CcRppl to validate the split leaf system
[0026] [0026] Figure 4. Alternative formula used to process raw qgRT-PCR readings.
[0027] [0027] Figure 5. Validation of the split leaf assay using CcRppl and a construct comprising SEQ ID NO: X showed a significant reduction in disease compared to the control.
[0028] [0028] Figure 6. Validation of split leaf assay of SEQ ID NO: 6 showing significant reduction in disease compared to control.
[0029] [0029] Figure 7. Results of the stable transformation (T1 events) showing three events that support SEQ ID NO: 21 offering about 80% disease control. The bar is plotted as the average of the b-tubulin fungal transcripts
[0030] [0030] Figure 8. Results of the stable transformation (TO events) showing two events that contain SEQ ID NO: 27 conferring resistance to soybean rust.
[0031] [0031] Figure 9. Leaf symptoms correlated to the gRT assay. BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0032] [0032] SEQ ID NOs: 1 & 2 are chromosomal intervals derived from the Glycine tomentella lineage with access PI441001 referred to here as “Support 46840” and “Support 49652" “respectively. Support 49652 was mapped on chromosome 5 of G. tomentella and Support 46840 was mapped to G. tomentella chromosome 5. SEQ ID NO. 3 is a chromosomal range derived from the Glycine tomentella lineage with PI 483224 access referred to here as “Support 002687F.” Support 002687F was mapped on chromosome 5 from G. tomentella SEQ ID NO. 4 is a chromosomal range derived from the Glycine tomentella lineage with PI 583970 access referred to here as “Support 001084F.” Support 001084F was mapped on chromosome 5 of G. tomentella. 5 is a chromosomal interval derived from the Glycine tomentella lineage with access PI583970 referred to here as “Contig O00819F” ". Contig (000819F was mapped on chromosome 5 of G. tomentella. Genetic population mapping studies for PI441001, PI483224 and PI 583970 indicate that Glycine tomentella Chromosome 5 contains chromosomal intervals highly associated with FAS resistance (for example, corresponding to SEQ ID NOs: 1-5) Additional data also indicate that the accessions of Glycine tomentella PI446958, PI499939, PI505220, PI499933, PI441008, PI5O5256, PI446961 and PI483224 can be used as a source for said chromosomal intervals or genes corresponding to SEQ ID NOs 1-5 These chromosomal intervals or their portions can be introduced (ie introgressed through the use of embryo rescue & marker-assisted breeding (MAB)) into Glycine max strains to create Glycine max strains resistant to various diseases , such as FAS. Single nucleotide (SNP) polymorphisms within SEQ ID NOs 1-5 that are associated with resistance to FAS are described in the Application PCT No. PCT / US2017 / 036712, published as Wo 2017/222827, incorporated herein by reference in its entirety.
[0033] [0033] Further research on the intervals led to the discovery of causative genes and associated native promoter and terminator sequences were identified from the above (or corresponding) interval (s) located on Glycine tomentella Chromosome 5.
[0034] [0034] SEQIDNO: 6 is a PI441001 soybean rust resistance gene that encodes a protein that contains Toll / Interleukin-1 receptors (TIR), nucleotide binding site (NBS), leucine rich repeat (LRR) and WKRY domains synthetic to Glyma.05G165800 (Soy william82 v2) (Here, a “TNLW 'motif of the R gene); the associated native promoter comprises SEQ ID NO: 7 and SEQ ID NO: 8 terminator sequence. SEQ ID NO: 6, encodes the protein of SEQ ID NO: 47.
[0035] [0035] SEQ ID NO: 9 is a PI441001 soybean rust resistance candidate gene that encodes a protein containing coiled spiral (CC) domains, nucleotide binding (NBS) and rich leucine repeating (LRR) domains. The gene is synthetic to Glyma.O5G165600 (Soy william82 v2) (Here, a motif of the R "CNL" gene); the associated native promoter comprises SEQ ID NO: 10 and SEQ ID NO: 11 terminator sequence. SEQ ID NO: 9, encodes the protein of SEQ ID NO: 48.
[0036] [0036] SEQ ID NO: 12 is a PI583970 soybean rust resistance gene that encodes a protein having a R CNL gene motif; the associated native promoter comprises SEQ ID NO: 13 and terminator sequence SEQ ID NO: 14. SEQ ID NO. 12, encodes the protein of SEQ ID NO: 42.
[0037] [0037] SEQ ID NO: 15 is a PI583970 soybean rust resistance candidate gene that encodes a protein having a R CNL gene motif; the associated promoter used for validation comprises SEQ ID NO: 16 and terminator sequence SEQ ID NO: 17. SEQ ID NO. 15, encodes the protein of SEQ ID NO: 43.
[0038] [0038] SEQ ID NO: 18 is a PI583970 soybean rust resistance gene that encodes a protein having an R CNL gene motif; the associated promoter used for validation comprises SEQ ID NO: 19 and terminator sequence SEQ ID NO: 20. SEQ ID NO. 18, encodes the protein of SEQ ID NO: 49.
[0039] [0039] SEQ ID NO: 21 is a candidate for rust resistance of PI446958 soybean that encodes a protein having a R CNL gene motif; the associated promoter used for validation comprises SEQ ID NO: 22 and terminator sequence SEQ ID NO: 23. SEQ ID NO: 21, encodes the protein of SEQ ID NO: 44.
[0040] [0040] SEQ ID NO: 24 is a PI446958 soybean rust resistance gene that encodes a protein having an R CNL gene motif; the associated native promoter comprises SEQ ID NO: 25 and terminator sequence SEQ ID NO: 26. SEQ ID NO: 24, encodes the protein of SEQ ID NO: 45.
[0041] [0041] SEQ ID NO: 27 is a PI446958 soybean rust resistance gene that encodes a protein having a R CNL gene motif; the associated promoter used for validation comprises SEQ ID NO: 28 and SEQ ID NO: 29 terminator sequence. SEQ ID NO: 27, encodes the SEQ ID NO: 46 protein.
[0042] [0042] SEQ ID NO: 30 is a candidate for rust resistance of PI583970 soybean that encodes a protein having a TNLW motif of the R gene; the associated native promoter comprises SEQ ID NO: 31 and SEQ ID NO: 32 terminator sequence. SEQ ID NO: 30, encodes the protein of SEQ ID NO: 50.
[0043] [0043] Additional ranges have been discovered in other strains of Glycine tomentella as illustrated in Table 1 below, which are associated with FAS resistance and correspond to the ranges described above with / comprising SEQ ID NOs 1-5 and also located on chromosome 5. O Interval mapping indicates that resistance to FAS can be found in the T1 and T2 lines of Glycine tomentella. In addition, it is contemplated that any of the original strains listed in Table 1 can be used to introduce resistance to FAS in elite Soy plants, through plant introgression by embryo rescue or through transgenic expression of genes encoding a protein having a CNL or TNLW motif of the R gene or a gene having between 70-100% homology to any of SEQ ID NOs: 6, 9, 12, 15, 18, 21, 24, 27 or 30. Contig / Brackets 001082F, 000221F, 000342F, 003716F, 001879F, 001273F, O0O0866F, OPO819F and 49562 are illustrated in SEQ ID NOs: 33, 34, 35, 36, 37, 38, 49, 40 and 41 respectively. It is contemplated that homologous sequences with functional FAS resistance genes related to the R genes, as illustrated in SEQ ID NOs: 6, 9, 12, 15, 18, 21, 24, 27 and 30 can be located in the intervals and associated sequences of Table 1.
[0044] [0044] Table 1: List of other sources and supports found that include intervals associated with increased resistance to Asian Soybean Rust. Type of Contig / e q E fe E
[0045] [0045] The subject currently disclosed refers to compositions and methods for the introduction of new resistance genes (here, "R Genes") in commercial soybean plants to control soybean pathogens. The methods involve transforming organisms with nucleotide sequences that encode the R genes of the invention. The nucleotide sequences of the invention are useful for the preparation of plants that show increased resistance to soybean pathogens, particularly Asian Soybean Rust (here, "FAS"). Therefore, transformed plants, plant cells, plant tissues and seeds are provided. The compositions include nucleic acids and proteins related to plants resistant to soybean pathogens, as well as transformed plants, plant tissues and seeds. Nucleotide sequences of the R genes and amino acid sequences of the proteins encoded by them are disclosed. The sequences find use in the construction of expression vectors for subsequent transformation in plants of interest, as probes for the isolation of other R genes, and the like.
[0046] [0046] It is possible to produce pathogen-resistant soy plants by inserting a DNA molecule into the plant's genome that provides resistance (Cook et al., 2012 for resistance to SCN; Kawashima et al., 2016 for resistance to Asian soybean rust angola pea).
[0047] [0047] This description is not intended to be a detailed catalog of all the different ways in which the invention can be implemented or all the features that can be added to the present invention. For example, the features illustrated with respect to one modality can be incorporated into other modalities and the features illustrated with respect to a particular modality can be eliminated from that modality. Thus, the invention contemplates that, in some embodiments of the invention, any feature or combination of features presented here can be excluded or omitted. In addition, numerous variations and additions to the various modalities suggested here will be clear to those skilled in the art in the light of the present disclosure, which do not depart from the present invention. Consequently, the following descriptions are intended to illustrate some particular embodiments of the invention and not to exhaustively specify all of its permutations, combinations and variations.
[0048] [0048] All references listed below, as well as all references cited in this disclosure, including, but not limited to, all patents, patent applications and publications, articles in scientific journals and database entries (for example, entries in the GENBANK6 database and all the annotations available therein) are hereby incorporated in their entirety by reference to the extent that they supplement, explain, provide a context or teach methodology, techniques and / or compositions employed here.
[0049] [0049] The nucleotide sequences provided in this document are presented in the 5 'to 3' direction, from left to right and are presented using the standard code to represent the nucleotide bases as established in 37 CFR $$ 81,821 - 1,825 and in the Standard ST.25 standard of the World Intellectual Property Organization (WIPO) for example: adenine (A), cytosine (C), thymine (T) and guanine (6).
[0050] [0050] Amino acids are likewise indicated using the WIPO Standard ST.25 Standard, for example: alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D ), cysteine (Cys; C), glutamine (Gln; Q), glutamic acid (Glu; E), glycine (Gly; G), histidine (His; H), isoleucine (Tle; 1), leucine (Leu; L ), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser
[0051] [0051] Unless otherwise defined, all technical and scientific terms used here have the same meaning commonly understood by the person skilled in the art to which the subject currently revealed belongs.
[0052] [0052] Although the following terms are supposed to be well understood by a person of ordinary skill in the art, the following definitions are presented to facilitate the understanding of the material currently disclosed.
[0053] [0053] As used in the description of the invention and the appended claims, the singular forms "one", "one" and "o / a" are intended to include plural forms as well, unless the context clearly indicates otherwise .
[0054] [0054] As used herein, “and / or” refers to, and encompasses, any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
[0055] [0055] The term "about", as used here when referring to a measurable value such as a dosage or time period and the like, is intended to encompass variations of + 20%, ++ 10%, + 5% + 1% + 0.5% or even + 0.1% of the specified quantity. As used here, phrases like "between about X and Y" mean "between about X and about Y" and phrases like "from about X to Y" mean "from about X to about Y".
[0056] [0056] As used here, phrases such as "between about X and Y", "between about X and about Y", "from X to Y" and "from about X to about Y" (and similar phrases ) should be interpreted to include X and Y, unless the context indicates otherwise.
[0057] [0057] A "coding sequence" is a sequence of nucleic acids that is transcribed into RNA, such as mRNA, rRNA, tRNA, sNRNA, sense RNA or antisense RNA. In modalities, the RNA is then translated to produce a protein.
[0058] [0058] As used here, a "codon-optimized" nucleotide sequence means a nucleotide sequence of a recombinant, transgenic or synthetic polynucleotide in which the codons are chosen to reflect the particular codon bias that a host cell or organism may have . This is typically done in order to preserve the amino acid sequence of the polypeptide encoded by the codon-optimized nucleotide sequence. In certain embodiments, a nucleotide sequence is codon-optimized for the cell (for example, an animal, plant, fungal or bacterial cell), in which the construct is to be expressed. For example, a construct to be expressed in a plant cell can have all or parts of its sequence that have codons optimized for expression in a plant. See, for example, U.S. Patent No. 6,121,014. In embodiments, the polynucleotides of the invention are codons optimized for expression in a plant cell (for example, a dicotyledon cell or a monocotyledon cell) or bacterial cell.
[0059] [0059] The term "comprises", "comprises" or "comprising", when used in this specification, indicates the presence of the characteristics, integers, steps, operations, elements or components referred to, but does not exclude the presence or addition of one or more other characteristics, integers, steps, operations, elements, components and / or groups thereof.
[0060] [0060] As used here, the transitional phrase “consisting essentially of” (and grammatical variants) means that the scope of a claim is to be interpreted as encompassing the specified materials or steps recited in the claim “and those that do not materially alter ( s) basic and new feature (s) ”of the claimed invention. Accordingly, the term "consisting essentially of" when used in a claim to this invention is not intended to be interpreted as being equivalent to "comprising".
[0061] "Expression cassette" as used herein means a nucleic acid molecule capable of directing the expression of at least one polynucleotide of interest, such as a polynucleotide of the R gene encoding a protein of the invention, in a host cell suitable, comprising a promoter operably linked to the polynucleotide of interest that is operably linked to a termination signal. An "expression cassette" also typically comprises additional polynucleotides to facilitate appropriate translation of the polynucleotide of interest. The expression cassette can also comprise other polynucleotides not related to the expression of a polynucleotide of interest, but which are present due to convenient restriction sites for removing the cassette from an expression vector. In embodiments, at least one of the components of the expression cassette can be heterologous (i.e., external), with respect to at least one of the other components (for example, a heterologous promoter operatively associated with a polynucleotide of interest). The expression cassette can also be a naturally occurring one, but it was obtained in a recombinant form useful for heterologous expression. Typically, however, the expression cassette is heterologous to the host,
[0062] [0062] A "gene" is defined here as an inherited unit comprising one or more polynucleotides, which occupies a specific location on a chromosome or plasmid and which contains the genetic instructions for a particular trait or trait in an organism.
[0063] [0063] The term "introduced", as used here in connection with a plant, means achieved in any way including, but not limited to: introgression, transgenic technique, modification of Short Palindromic Repetitions Grouped and Regularly Interspaced (CRISPR), Nucleases effectors of the transcription activator type (TALEN) (Feng et al. 2013, Joung & Sander 2013), meganucleases or zinc finger nucleases (ZFN).
[0064] [0064] As used here, the term "wild glycine" refers to a perennial Glycine plant, for example any of G. canescens, G. argyrea, G. clandestine, G. latrobeana, G. albicans, G. aphyonota , G. arenaria, G. curvata, OG. cyrtoloba, G. dolichocarpa, G. falcate, G. gracei, GG. hirticaulis, G. lactovirens, G. latifolia, G. microphylla,
[0065] [0065] As used here, the term "allele" refers to one of two or more different nucleotides or nucleotide sequences that occur at a specific locus.
[0066] [0066] A marker is "associated with" a trace when it is linked to it and when the presence of the marker is an indicator of whether and / or to what extent the desired trace or trace shape will occur in a plant / germplasm comprising the marker. Similarly, a marker is "associated with" an allele when it is attached to it and when the presence of the marker is an indicator of whether the allele is present in a germinal plant / plasma comprising the marker. For example, “a marker associated with increased resistance to pathogens” refers to a marker whose presence or absence can be used to predict whether and / or to what extent a plant will exhibit a pathogen resistant phenotype (for example, any SNP allele) favorable described in Tables 1-5 is “associated with” resistance to FAS in a soybean plant).
[0067] [0067] As used here, the terms "backcross" and "backcross" refer to the process by which a progeny plant is repeatedly backcrossed with one of its parents. In a backcrossing scheme, the “donor” parent refers to the paternal plant with the desired gene or locus to be subjected to introgression. The “recipient” parent (used one or more times) or the “recurrent” parent (used two or more times) is related to the parent plant in which the gene or locus is being subjected to introgression. For example, see Ragot, M. et al. Marker-assisted Backcrossing: A Practical Example, in TECHNIQUES ET UTILIZATIONS DES MARQUEURS MOLECULAIRES LES CoLLOQUES, Vol. 72, pages 45-56 (1995); and Openshaw et al., Marker-assisted Selection in Backcross Breeding, in PROCEEDINGS OF THE SYMPOSIUM “ANALYSIS OF MOLECULAR MARKER DATA,” pages 41-53 (1994). The initial crossing gives rise to the F1 generation. The term “BC1” refers to the second use of the recurring parent, “BC2” refers to the third use of the recurring parent, and so on.
[0068] [0068] A centimorgan ("cM") is a unit of measurement for the frequency of recombination. One cM is equal to 1% probability that a marker at a genetic locus is separated from a marker at a second locus due to exchange in a single generation.
[0069] [0069] As used here, the term "chromosomal range defined by and including", used in relation to particular loci and / or alleles, relates to a chromosomal range delimited by and encompassing the stated loci / alleles.
[0070] [0070] As used here, the terms "cross" or "cross" refer to the fusion of gametes via pollination to produce progeny (for example, cells, seeds or plants). The term covers sexual crosses (the pollination of one plant by another) and self-fertilization (self-pollination, for example, when the pollen and egg come from the same plant). The term “crossover” refers to the act of fusing gametes through pollination to produce progeny.
[0071] [0071] As used here, the terms "cultivar" and "variety" refer to a group of similar plants that can be distinguished from other varieties within the same species by structural or genetic characteristics and / or performance.
[0072] [0072] As used here, the terms "desired allele", "favorable allele" and / or "allele of interest" are used interchangeably to refer to an allele associated with a desired trait (for example, resistance to FAS).
[0073] [0073] As used here, the terms "increased resistance to pathogens" or "increased resistance to disease" refer to an improvement, intensification, or increased ability of a plant to tolerate and / or thrive despite being infected with a disease (for example, Asian soybean rust) compared to one or more control plants (for example, one or both parents, or a plant lacking a marker associated with increased pathogen resistance to the respective pathogen / disease). Increased disease resistance includes any mechanism (other than immunity or resistance of whole plants) that reduces the expression of infection-indicating symptoms for a respective disease, such as Asian soybean rust, soybean cyst-forming nematode, Pytophthora, etc.
[0074] [0074] An "elite line" or "elite line" is an agronomically superior line that resulted from many breeding and selection cycles for superior agronomic performance. Numerous elite strains are available and are known to those skilled in the art of soy improvement. An “elite population” is a variety of elite individuals or lineages that can be used to represent the state of the art in terms of agronomically superior genotypes for a given crop species, such as soybeans. Similarly, an “elite germplasm” or elite strain of germplasm is an agronomically superior germplasm, typically derived from and / or capable of originating a plant with superior agronomic performance, such as an existing or newly developed elite strain of soy.
[0075] [0075] An "elite" plant is any plant in an elite line, in such a way that an elite plant is a plant representative of an elite variety. Non-limiting examples of elite soybean varieties that are commercially available to soybean farmers or breeders include: AGOO8O2, AOSG8, AGO9NO2, Al923, AG2403, A2824, A3704, A4324, A5404, AG5903, AGG6202 AGO934; AG1435; AG2031; AG2035; AG2433; AG2733; AG2933; AG3334; AG3832;
[0076] [0076] The term “agronomically elite” as used here, means a genotype that is the culmination of many distinguishable traits such as emergence, vigor, vegetative vigor, disease resistance, seed set, ability to remain upright, yield and ability to threshing that allows a producer to collect a product of commercial importance.
[0077] [0077] As used herein, the term "commercially significant yield" or "agronomically acceptable yield" relates to a grain yield of at least 100% from a variety of commercial control, such as AG2703 or DKB23-51.
[0078] [0078] A "native" or "wild-type" nucleic acid, nucleotide sequence, polypeptide or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide or amino acid sequence. Thus, for example, a "wild-type mRNA" is a mRNA that occurs naturally in or is endogenous to the organism.
[0079] [0079] The terms "nucleic acid", "nucleic acid molecule", "nucleotide sequence", "oligonucleotide" and "polynucleotide" are used interchangeably, unless the context indicates otherwise, and refer to a heteropolymer of nucleotides. These terms include, without limitation, DNA and RNA molecules, including cDNA, genomic DNA, synthetic DNA and RNA (for example, chemically synthesized), plasmid DNA, mRNA, antisense RNA and RNA / DNA hybrids, any of which can be straight or branched, single-stranded or double-stranded, or a combination thereof. When dsRNA is produced synthetically, less common bases, such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others can also be used for pairing antisense, dsRNA and ribozymes. For example, it has been shown that polynucleotides that contain C-5 brine analogs of uridine and cytidine bind to RNA with high affinity and are potent antisense inhibitors of gene expression. Other modifications can also be made, such as modification of the phosphodiester backbone or 2-hydroxy structure in the RNA ribose sugar group. In modalities, the "nucleic acid", "nucleic acid molecule", "nucleotide sequence", "oligonucleotide" or "polynucleotide" refers to DNA.
[0080] [0080] By "operationally linked" or "operationally associated" as used here is meant that the indicated elements are functionally related to each other, and are also generally physically related. Accordingly, the term "operably linked" or "operatively linked" as used herein refers to nucleotide sequences in a single nucleic acid molecule that are functionally associated. Thus, a first nucleotide sequence that is operationally linked to a second nucleotide sequence, means a situation in which the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence. For example, a promoter is operationally associated with a nucleotide sequence if the promoter transcribes or expresses said nucleotide sequence. Those skilled in the art will appreciate that the control sequences (e.g., promoter) do not need to be contiguous with the nucleotide sequence to which it is operationally associated, as long as the control sequences function to direct its expression. Thus, for example, intervening untranslated but transcribed sequences can be present between a promoter and a nucleotide sequence, and the promoter can still be considered "operationally linked" to or "operationally associated" with the nucleotide sequence.
[0081] [0081] As used here, the terms "disease tolerance" and "disease resistant" relate to a plant's ability to withstand and / or thrive despite being infected with a respective disease. When used in connection with germplasm, the terms relate to the ability of a plant that arises from germplasm to withstand and / or thrive despite being infected with a respective disease. In some modalities, soybean plants resistant to infected diseases can have as good (or almost as good) yield as uninfected soybean plants. In general, a plant or germplasm is marked as "Resistant to disease" if it exhibits "increased resistance to pathogens".
[0082] [0082] As used here, the term "endogenous" refers to materials originating from an organism or cell. “Exogenous” refers to materials originating outside of an organism or cell. This generally applies to nucleic acid molecules used in the production of transformed or transgenic host cells and plants.
[0083] [0083] As used here, the terms "exotic", "exotic lineage" and "exotic germplasm" refer to any plant, lineage or germplasm that is not elite. In general, exotic germinal plants / plasma are not derived from any known elite germplasm or plasma, but are instead selected to introduce one or more desired genetic elements into an breeding program (for example, to introduce new alleles into an breeding program).
[0084] [0084] As used here, a "genetic map" is a description of genetic linkage relationships between loci on one or more chromosomes within a given species, usually represented in a diagram or table form. For each genetic map, the distances between loci are measured by the frequencies of recombination between them. Recombinations between loci can be detected using a variety of markers. A genetic map is a product of the mapping population, types of markers used and the polymorphic potential of each marker between different populations. The order and genetic distances between loci may differ from one genetic map to another.
[0085] [0085] As used here, the term "genome" as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but also organelle DNA found within the cell's subcellular components. The term "gene" refers to polynucleic acids that comprise chromosomal DNA, plasmid DNA, cDNA, an artificial DNA polynucleotide or other DNA that is transcribed into an RNA molecule, where the RNA can encode a peptide, polypeptide or protein, and the genetic elements that flank the coding sequence that are involved in regulating the expression of the mRNA or polypeptide of the present invention. A “fragment” of a gene is a portion of a full-length polynucleic acid molecule that is at least a minimum length capable of transcription to an RNA, translation to a peptide, or useful as a probe or primer in a method of detecting DNA.
[0086] [0086] As used here, the term “genotype” refers to the genetic makeup of an individual (or group of individuals) at one or more genetic loci, in contrast to the observable and / or detectable and / or manifested trait (the phenotype ). The genotype is defined by the allele (s) of one or more known loci that the individual inherited from his parents. The term genotype can be used to refer to an individual's genetic make-up at a single locus, at multiple loci, or more generally, the term genotype can be used to refer to an individual's genetic make-up for all the genes in their genome. Genotypes can be indirectly characterized, for example, using markers, and / or directly characterized, by nucleic acid sequencing.
[0087] [0087] As used here, the term "germplasm" refers to genetic material from or from an individual (eg, a plant), a group of individuals (eg, a lineage, variety or family of plants) or a clone derived from a lineage, variety, species or culture. The germplasm can be part of an organism or cell, or it can be separated from the organism or cell. In general, germplasm provides genetic material with a specific molecular constitution that provides a physical foundation for some or all of the inherited qualities of an organism or cell culture. As used here, germplasm can relate to seeds, cells (including protoplasts and calluses) or tissues from which new plants can grow, as well as parts of plants that can be grown on a complete plant (for example, stems, shoots, roots, leaves, etc.).
[0088] [0088] As used here, a "Heterologous DNA" sequence refers to a sequence of polynucleotides that originates from an external source or species or, if from the same source, is modified from its original form.
[0089] [0089] As used here, a "Homologous DNA" refers to DNA from the same source as that of the recipient cell.
[0090] [0090] As used here, the term "hybrid" refers to a seed and / or plant produced when at least two genetically different parents are crossed.
[0091] [0091] As used here, the term "Identity" refers to the degree of similarity between two polynucleic acid or protein sequences. An alignment of the two sequences is performed by an appropriate algorithm. A widely used and accepted computer program for performing sequence alignment is CLUSTALW v1.6 (Thompson et al .. Nucl. Acids Res., 22 4673-4680, 1994), although others are commonly used. The number of compatible bases or amino acids is divided by the total number of bases or amino acids and multiplied by 100 to obtain a percentage of identity. For example, if two 580 base pair sequences have 145 compatible bases, they would be 25 percent identical. If the two strings compared are of different lengths, the number of compatibilities is divided by the shorter of the two lengths. For example, if there are 100 amino acids paired between 200 amino acid and 400 protein, they are 50 percent identical for the shortest sequence. If the shortest sequence is less than 150 bases or 50 amino acids in length, the number of compatibilities is divided by 150 (for nucleic acid bases) or 50 (for amino acids), and multiplied by 100 to obtain a percentage of identity. In addition to identity positions, consensus positions are also commonly scored. Consensus amino acids are those that have similar amino acid properties, such as charge, size, polarity and aromaticity.
[0092] [0092] As used here, the term "inbreeding" refers to a substantially homozygous plant or variety. The term can refer to a plant or variety that is substantially homozygous over the entire genome or that is substantially homozygous for a portion of the genome that is of particular interest.
[0093] [0093] As used herein, the term "indel" refers to an insertion or deletion in a pair of nucleotide sequences, where a first sequence can be referred to as having an insertion with respect to a second sequence or the second sequence can be reported as having a deletion with respect to the first sequence.
[0094] [0094] As used here, the terms "introgression", "introgressing" and "introgression" refer to the natural and artificial transmission of a desired allele or desired combination of alleles from one genetic locus or genetic loci from one genetic context to another. For example, a desired allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one parent has the desired allele in its genome. Alternatively, for example, the transmission of an allele can occur by recombination between two donor genomes,
[0095] [0095] As used herein, an "isolated" nucleic acid molecule is substantially separated from other nucleic acid sequences with which the nucleic acid is normally associated, such as, from the chromosomal or extrachromosomal DNA of a cell in which the nucleic acid occurs naturally. A nucleic acid molecule is an isolated nucleic acid molecule when it comprises a transgene or part of a transgene present in the genome of another organism. The term also encompasses nucleic acids that are biochemically purified in order to substantially remove contaminating nucleic acids and other cellular components. The term “transgene” refers to any polynucleic acid molecule that is normative for a cell or organism transformed into the cell or organism. "Transgene" also encompasses the component parts of a native plant gene modified by the insertion of a normative polynucleic acid molecule by targeted recombination or site-specific mutation.
[0096] [0096] A polypeptide is "isolated" if it has been separated from cellular components (nucleic acids, lipids, carbohydrates and other polypeptides) that accompany it naturally or that is chemically synthesized or recombinant. A polypeptide molecule is an isolated polypeptide molecule when it is expressed from a transgene in another organism. A monomeric polypeptide is isolated when at least 60% by weight of a sample is composed of the polypeptide, preferably 90% or more, more preferably 95% or more and more preferably more than 99%. The purity or homogeneity of the protein is indicated, for example, by polyacrylamide gel electrophoresis of a protein sample, followed by the visualization of a single polypeptide band after staining the polyacrylamide gel; high pressure liquid chromatography; or other conventional methods. Proteins can be purified by any of the means known in the art, for example, as described in “Guide to Protein Purification” ", publisher Deutscher, Meth. Enzymol. 185,
[0097] [0097] Using well-known methods, the person skilled in the art can easily produce variants of the nucleotide and amino acid sequence of genes and proteins that provide a modified genetic product. Chemical synthesis of nucleic acids can be carried out, for example, in automated oligonucleotide synthesizers. Such variants preferably do not alter the reading frame of the coding region of the nucleic acid protein. The present invention also encompasses fragments of a protein that lack at least one residue of a full-length protein, but that substantially maintains the activity of the protein.
[0098] [0098] A "locus" is a position on a chromosome where a gene or marker or allele is located. In some embodiments, a locus may encompass one or more nucleotides.
[0099] [0099] A "variety of non-naturally occurring soy" is any variety of soy that does not exist naturally in nature. A "variety of non-naturally occurring soybeans" can be produced by any method known in the art, including, but not limited to, transformation of a soybean plant or germline plasma, transfection of a soybean plant or germline plasma and crossing a variety of naturally occurring soybeans with a variety of non-naturally occurring soybeans. In some embodiments, a "non-naturally occurring soybean variety" may comprise one of more heterologous nucleotide sequences. In some embodiments, a "non-naturally occurring soybean variety" may comprise one or more non-naturally occurring copies of a naturally occurring nucleotide sequence (that is, external copies of a naturally occurring gene in soy). In some embodiments, a "non-naturally occurring soybean variety" may comprise an unnatural combination of two or more naturally occurring nucleotide sequences (ie, two or more naturally occurring genes that do not occur naturally in the same soy, for example , genes not present in Glycine max strains).
[0100] [0100] As used herein, the terms "phenotype", "phenotypic trait" or "trait" refer to one or more traits and / or manifestations of an organism. The phenotype can be a manifestation that is observable with the naked eye, or by any other means of evaluation known in the art, for example, microscopy, biochemical analysis or an electromechanical assay. In some cases, a phenotype or trait is directly controlled by a single gene or genetic locus, that is, a "single gene trait". In other cases, a phenotype or trait is the result of several genes. Note that, as used here, the term “disease resistant phenotype” takes into account environmental conditions that can affect the respective disease, so that the effect is real and reproducible.
[0101] [0101] As used herein, the term "plant" can refer to a complete plant, any part thereof, or to a cell or tissue culture derived from a plant. Thus, the term “plant” can refer to: complete plants, plant components or organs (for example, roots, stems, leaves, buds, flowers, pods, etc.), plant tissues, seeds and / or plant cells. plants. A plant cell is a cell from a plant, taken from a plant, or derived by culturing a cell taken from a plant. Thus, the term "soybean plant" can refer to a complete soybean plant, one or more parts of a soybean plant (for example, roots, root tips, stems, leaves, buds, flowers, pods, seeds, cotyledons, etc.), soybean plant cells, soybean plant protoplasts and / or soybean plant calluses.
[0102] [0102] A "plant cell" is a structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell can be in the form of a single isolated cell or a cultured cell or as part of a higher organization unit such as, for example, plant tissue, a plant organ or an entire plant. In the modalities, the plant cell does not propagate and / or cannot regenerate an entire plant.
[0103] [0103] A "plant cell culture" means a culture of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, eggs, embryonic sacs, zygotes and embryos at various stages of development.
[0104] [0104] “Plant material” refers to leaves, stems, roots, flowers or parts of flowers, fruits, pollen, eggs, zygotes, seeds, cuttings, cell or tissue cultures or any other part or product of a plant.
[0105] [0105] A "plant organ" is a distinct and visibly structured and differentiated part of a plant such as a root, stem, leaf, flower bud or embryo.
[0106] [0106] As used herein, the term "plant part" includes but is not limited to embryos, pollen, ova, seeds, leaves, flowers, branches, fruit, stems, roots, root tips, anthers, and / or plant cells including plant cells that are intact in plants and / or parts of plants, plant protoplasts, plant tissues, cell cultures of plant tissues, plant calluses, plant tufts, and the like.
[0107] [0107] "Plant tissue" as used here means a group of plant cells organized into a structural and functional unit. Any tissue from a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture and any groups of plant cells organized into structural or functional units. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as listed above or otherwise covered by this definition is not intended to be exclusive to any other type of plant tissue.
[0108] [0108] "Polyadenylation signal" or "polyA signal" refers to a nucleic acid sequence located 3 'to a coding region that causes the addition of adenylate nucleotides to the 3' end of the transcribed mRNA of the coding region.
[0109] [0109] "Polymerase chain reaction (PCR)" refers to a method of DNA amplification that uses an enzymatic technique to create multiple copies of a nucleic acid sequence (amplicon). Copies of a DNA molecule are prepared carrying a DNA polymerase between two amplimeters. The basis of this amplification method is multiple cycles of temperature changes to denature, then re-pair the amplimeters (DNA primer molecules), followed by extension to synthesize new DNA strands in the region located between flanking amplimeters. Nucleic acid amplification can be performed by any of the various nucleic acid amplification methods known in the art, including polymerase chain reaction (PCR)
[0110] [0110] As used here, the term "primer" refers to an oligonucleotide that is able to pair with a nucleic acid target and serve as a starting point for DNA synthesis when placed under conditions in which the synthesis of a primer extension product (for example, in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at an appropriate temperature and pH). An initiator (in some embodiments an extension initiator and in some embodiments an amplification initiator) has, in some embodiments, a simple ribbon for maximum efficiency of the extension and / or amplification. In some embodiments, the primer is an oligodeoxyribonucleotide. A primer is typically long enough to initiate the synthesis of extension and / or amplification products in the presence of the agent for polymerization. The minimum length of the initiator can depend on many factors, including, but not limited to, the temperature and composition (A / T content versus G / C) of the initiator.
[0111] [0111] As used herein, the terms "progeny" and "progeny plant" refer to a plant generated from a vegetative or sexual reproduction of one or more parent plants. An offspring plant can be obtained by cloning or self-fertilizing a single parent plant or by crossing two parent plants.
[0112] [0112] The term "promoter" or "promoter region" refers to a molecule of polynucleic acid that functions as a regulatory element, generally found upstream (5 ') of a coding sequence, which controls the expression of the coding sequence by controlling the production of messenger RNA (mRNA) by providing the RNA polymerase recognition site and / or other factors necessary for transcription to begin at the correct location. As contemplated herein, a promoter or promoter region includes variations of promoters derived by binding to various regulatory sequences, random or controlled mutagenesis and addition or duplication of enhancer sequences. The promoter region disclosed herein, and its biologically functional equivalents, are responsible for conducting the transcription of coding sequences under its control when introduced into a host as part of a suitable recombinant DNA construct, as demonstrated by its ability to produce mRNA.
[0113] [0113] A "recombinant" nucleic acid is produced by a combination of two separate segments of the nucleic acid sequence, for example, by chemical synthesis or by manipulating isolated segments of polynucleic acids by genetic manipulation techniques. The term "recombinant DNA construct" refers to any agent, such as a plasmid, cosmid, virus, autonomous replication sequence, phage or nucleotide sequence of single-stranded or double-stranded, linear or circular DNA or RNA, derived from any source, capable of genomic integration or autonomous replication, comprising a DNA molecule in which one or more DNA sequences have been linked in a functionally operational way. Such recombinant DNA constructs are capable of introducing a 5 'regulatory sequence or promoter region and a DNA sequence for a selected gene product in a cell in such a way that the DNA sequence is transcribed into a functional mRNA that is translated and, therefore, expressed. The recombinant DNA constructs can be constructed to be able to express antisense RNA or stabilized double stranded antisense RNA.
[01141] [01141] The term "substantially identical (a)" in the context of two nucleic acid sequences or two amino acid sequences, refers to two or more sequences or subsequences that have at least about 50% nucleotide residue identity or amino acid when compared and aligned for maximum match as measured using a sequence comparison algorithm or by visual inspection. In certain embodiments, substantially identical sequences are at least about 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 8%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more nucleotide or amino acid residue identity. In certain embodiments, there is a substantial identity across a region of the sequences that is at least about 50 amino acid residues, 100 amino acid residues, 150 amino acid residues, 200 amino acid residues, 250 amino acid residues, 300 amino acid residues . 350 amino acid residues, 400 amino acid residues, 450 amino acid residues, 500 amino acid residues, 525 amino acid residues, 526 amino acid residues, 528 amino acid residues, 528 amino acid residues, 529 amino acid residues, 530 amino acid residues, 531 amino acid residues, 532 amino acid residues, 533 amino acid residues, 534 amino acid residues, 535 amino acid residues, 536 amino acid residues or more in relation to the protein sequence or the nucleotide sequence encoding it. In additional embodiments, the sequences are substantially identical when they are identical over the entire length of the coding regions.
[0115] [0115] "Identity" or "percentage of identity" refers to the degree of identity between two nucleic acid or amino acid sequences. For sequence comparison,
[0116] [0116] For sequence comparison, typically a sequence acts as a reference sequence with which the test sequences are compared. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, if necessary subsequence coordinates are designated and parameters from the sequence algorithm program are designated. The sequence comparison algorithm then calculates the sequence identity percentage for the test sequence (s) relative to the reference sequence, based on the designated program parameters.
[0117] [0117] The optimal alignment of sequences for comparison can be accomplished, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981) by Needleman & homology alignment algorithm
[0118] [0118] An example of an algorithm that is suitable for determining the percentage of sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215: 403-410 (1990). The software for performing BLAST analyzes is publicly available through the National Center for Biotechnology Information (on the internet at ncbi.nlm.nih.gov/). This algorithm involves first identifying high-scoring sequence pairs (HSP) by identifying short words of length W in the query sequence, which match or satisfy some threshold T score of positive value when aligned with a word of the same length in a database string. T is referred to as a proximity word threshold score (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)). These initial proximity word hits act as seeds to initiate searches to find longer HSP containing them. The word hits are then extended in both directions throughout each sequence as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always> 0) and N (penalty score for unmatched residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. The extension of word matches in each direction is interrupted when the cumulative alignment score drops from an amount X from its maximum value reached, the cumulative score tends to zero or less due to the accumulation of one or more punctuation residue alignments negative or the end of either sequence is reached. The BLAST algorithm's W, T and X parameters determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) defaults to a word length (W) of 11, an expectation (E) of 10, a cut of 100, M = 5, N = -4 and a comparison of both strands . For amino acid sequences, the BLASTP program defaults to a word length (W) of 3, an expectation (E) of 10 and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89 : 10915 (1989)).
[0119] [0119] In addition to the calculation of the sequence identity percentage, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90: 5873 -5787 (1993)). A measure of the similarity provided by the BLAST algorithm is the least probability of sum (P (N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the least probability of sum in a comparison of the test nucleic acid sequence with the reference nucleic acid sequence is less than about 0, 1, more preferably less than about 0.01 and more preferably less than about 0.001.
[0120] [0120] Another widely used and accepted computer program to perform sequence alignment is CLUSTALW v1.6 (Thompson, et al. Nuc. Acids Res., 22: 4673-4680, 1994). The number of bases or corresponding amino acids is divided by the total number of bases or amino acids and multiplied by 100 to obtain a percentage of identity. For example, if two sequences of 580 base pairs have 145 compatible bases, they would be 25 percent identical. If the two strings compared are of different lengths, the number of compatibilities is divided by the shorter of the two lengths. For example, if there are 100 compatible amino acids between proteins of 200 and 400 amino acids, they are 50 percent identical to the shortest sequence. If the shortest sequence is less than 150 bases or 50 amino acids in length, the number of matches is divided by 150 (for nucleic acid bases) or 50 (for amino acids) and multiplied by 100 to obtain a percentage of identity.
[0121] [0121] Two nucleotide sequences can also be considered to be substantially identical when the two sequences hybridize to each other under stringent conditions. In representative embodiments, two nucleotide sequences considered to be substantially identical hybridize to each other under highly stringent conditions.
[0122] [0122] The terms "stringent conditions" or "stringent hybridization conditions" include reference to conditions under which a nucleic acid will selectively hybridize to a target sequence to a detectably greater degree than other sequences (for example, at least, 2 times in a non-target sequence) and, optionally, can substantially exclude binding to non-target sequences. Strict conditions are sequence dependent and will vary under different “circumstances. By controlling the stringency of the hybridization and / or washing conditions, target sequences can be identified that can be up to 100% complementary to the reference nucleotide sequence. Alternatively, conditions of moderate or even low stringency can be used to allow some disparities in sequences so that lower degrees of sequence similarity are detected. For example, those skilled in the art will understand that, to function as a primer or probe, a nucleic acid sequence only needs to be sufficiently complementary to the target sequence to substantially bind to it to form a stable double-stranded structure. under the conditions employed. In this way, primers or probes can be used under high, moderate or even low stringency conditions. Likewise, conditions of low or moderate stringency may be advantageous for detecting homologous, orthologous and / or parallel sequences that have lesser degrees of sequence identity than would be identified under highly stringent conditions.
[0123] [0123] The terms "complementary" or "complementarity" (and similar terms), as used herein, refer to the natural binding of polynucleotides under permissive temperature and salt conditions by base pairing. For example, the sequence "A-G-T" binds to the complementary sequence "T-C-A". The complementarity between two single-stranded molecules can be partial, where only a few of the nucleotides bind, or it can be complete when full complementarity exists between single-stranded molecules. The degree of complementarity between nucleic acid filaments has significant effects on the efficiency and strength of hybridization between the molecules As used herein, the term "substantially complementary" (and similar terms) means that two nucleic acid sequences are at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more complementary. Alternatively, the term "substantially complementary" (and similar terms) may mean that two nucleic acid sequences can hybridize together under conditions of high stringency (as described in this document).
[0124] [0124] As used herein, hybridizing "specifically" or "selectively" (and similar terms) refers to the binding, duplication or hybridization of a molecule to a particular target nucleic acid sequence under stringent conditions when that sequence is present in a mixture complex (for example, DNA or total cellular RNA) for substantial exclusion of non-target nucleic acids, or even without detectable binding, duplication or hybridization with non-target sequences. Hybridization sequences specifically or selectively are typically at least about 40% complementary and are optionally substantially complementary or even completely complementary (i.e., 100% identical).
[0125] [0125] For DNA-DNA hybrids, Tn can be approximated from the Meinkoth and Wahl, Anal equation. Biochem.,
[0126] [0126] Typically, stringent conditions are those in which the salt concentration is less than about 1.5 M Na ion, typically a concentration of about 0.01 to 1.0 M Na ion (or other salts ) at about pH 7.0 to pH 8.3 and the temperature is at least about 30 “C for short probes (for example, 10 to 50 nucleotides) and at least about 60 ° C for longer probes (for example, greater than 50 nucleotides). Strict conditions can also be achieved with the addition of destabilizing agents such as formamide or Denhardt (5 g of Ficoll, 5 g of polyvinylpyrrolidone, 5 g of bovine serum albumin in 500 ml of water). Exemplary low stringency conditions include hybridization with a buffer solution of 30% to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37 ° C and a wash in 1X to 2X SSC (20X SSC = 3.0 M NaCl / 0.3 M trisodium citrate) at 50 “Ca 55“ C. Exemplary moderate stringency conditions include hybridization to 40% to 45% formamide, 1 M NaCl, 1% SDS at 37 ° C and a wash in 0.5X to 1X SSC at 55 “C at 60 ° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 * C and a wash in 0.1X SSC at 60 ° C at 65 “C. An additional non-limiting example of high stringency conditions includes hybridization in 4X SSC, 5X Denhardt, 0.1 mg / ml of boiled salmon sperm DNA and 25 mM Na phosphate at 65 “C and a wash at 0 ° C, 1X SSC, 0.1% SDS at 65 “C. Another illustration of high stringency hybridization conditions includes hybridization in 7% SDS, 0.5 M NaPOas, 1 mM EDTA at 50 ºC with washing in 2X SSC, 0.1% SDS at 50 ºC, alternatively with washing in 1X SSC, 0.1% SDS at 50 ºC, alternatively with washing in 0.5X SSC, 0.1% SDS at 50 ºC or, alternatively, with washing in 0.1X SSC, 0.1% SDS at 50 ºC, or with washing in 0.1X SSC, 0.1% SDS at 65 ºC. Those skilled in the art will understand that specificity is typically a function of washes after hybridization, the relevant factors being the ionic strength and temperature of the final wash solution.
[0127] [0127] Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially - identical (for example, due to the degeneracy of the genetic code).
[0128] [0128] An additional indication that two nucleic acids or proteins are substantially identical is that the protein encoded by the first nucleic acid is immunologically cross-reactive with the protein encoded by the second nucleic acid. Thus, a protein is typically substantially identical to a second protein, for example, when the two proteins differ only in conservative substitutions.
[0129] [0129] The term "vector" refers to a composition for transferring, distributing or introducing a nucleic acid (or nucleic acids) into a cell. A vector comprises a nucleic acid molecule comprising the nucleotide sequence (s) to be transferred, distributed (s) or introduced (s). Expression of a Coding Sequence of the R gene in Plants
[0130] [0130] DNA constructs are made that contain several “genetic elements necessary for the expression of the Gene R coding sequence in plants. “DNA construct” refers to the heterologous genetic elements operatively linked together that make up a recombinant DNA molecule and can comprise elements that provide expression of a DNA polynucleotide molecule in a host cell and elements that provide maintenance of the construct in the host cell. A plant expression cassette comprises the operable linkage of genetic elements which, when transferred to a plant cell, provide the expression of a desirable gene product. "Plant expression cassette" refers to chimeric DNA segments that comprise the regulatory elements that are operationally linked to provide the expression of a transgenic product in plants. Promoters, leaders, introns, transit peptides that encode polynucleic acids, 3 'transcriptional termination regions are all genetic elements that can be operationally linked by those skilled in the art of plant molecular biology to provide a desirable level of expression or functionality to a gene. R of the present invention. A DNA construct can contain one or more plant expression cassettes that express the DNA molecules of the present invention or other DNA molecules useful in the genetic manipulation of cultured plants.
[0131] [0131] A variety of promoters specifically active in vegetative tissues, such as leaves, stems, roots and tubers, can be used to express the polynucleic acid molecules of the R gene of the present invention.
[0132] [0132] The leading translation sequence means a DNA molecule located between the promoter of a gene and the coding sequence. The leading translation sequence is present in the fully processed mMRNA upstream of the translation start sequence. The leading translation sequence can affect the processing of the primary mRNA transcript, mRNA stability or translation efficacy. Examples of leading translation sequences include maize and petunia heat shock protein leaders, plant virus coat protein leaders, plant rubisco gene leaders, among others (Turner and Foster, Molecular Biotechnology 3: 225, 1995) .
[0133] [0133] "Untranslated 3 'sequences" mean DNA sequences located downstream of a structural polynucleotide sequence and include sequences that encode polyadenylation and other regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal works in plants to cause the addition of polyadenylate nucleotides to the 3 'end of the mRNA precursor. The polyadenylation sequence can be derived from the natural gene, from a variety of plant genes, or from T-DNA. An example of the polyadenylation sequence is the 3 'sequence of nopaline synthase (nos 3'; Fraley et al., Proc. Natl. Acad. Sci. USA 80: 4803-4807, 1983). The use of different 3 'untranslated sequences is exemplified by Ingelbrecht et al., Plant Cell 1: 671-680,
[0134] [0134] The laboratory procedures in the recombinant DNA technology used here are those well known and commonly employed in the art. Standard techniques are used for cloning, DNA and RNA isolation, amplification and purification. Generally, enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like are carried out according to the manufacturer's specifications. These techniques and several other techniques are generally performed according to Sambrook et al. (1989).
[0135] [0135] The DNA construct of the present invention can be introduced into the genome of a desired plant host by a variety of conventional transformation techniques that are well known to those skilled in the art. “Transformation” refers to a process of introducing an exogenous polynucleic acid molecule (for example, a DNA construct, a recombinant polynucleic acid molecule) into a cell or protoplasts and that exogenous polynucleic acid molecule is incorporated into a genome host cell or an organelle genome (for example, chloroplast or mitochondria) or is capable of autonomous replication. “Transformed” or “transgenic” refers to a cell, tissue, organ or organism in which an external polynucleic acid, such as a DNA vector or recombinant polynucleic acid molecule. A “transgenic” or “transformed” cell or organism also includes the progeny of the cell or organism and the progeny produced from a selective breeding program that employs a “transgenic” plant as a parent at an intersection and exhibits an altered phenotype resulting from presence of the external polynucleic acid molecule.
[0136] [0136] Methods of transforming plant cells or tissues include, among others, the Agrobacterium-mediated transformation method and the Biolistic or particle gun-mediated transformation method. Plant transformation vectors suitable for Agrobacterium-mediated transformation purposes include those elements derived from a tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens, for example, right border regions (RB) and left border regions (LB), and others disclosed by Herrera-Estrella et al., Nature 303: 209 (1983); Bevan, Nucleic Acids Res. 12: 8711-8721 (1984); Klee et al., Bio-Technology 3 (7): 637-642 (1985). In addition to the plant transformation vectors derived from the Ti or Agrobacterium root (Ri) induction plasmids, alternative methods can be used to insert the DNA constructs of this invention into plant cells. Such methods may involve, but are not limited to, for example, the use of liposomes, electroporation, chemicals that increase the absorption of free DNA, free delivery of DNA through bombardment of microprojectiles and transformation using viruses or pollen.
[0137] [0137] DNA constructs that incorporate the coding sequences of the R gene of the present invention can be prepared for use in directing the expression of the sequences directly from the plastid of the host plant cell. Examples of such constructs suitable for this purpose and methods that are known in the art and are generally described, for example, in Svab et al., Proc. Natl. Acad. Sci. USA 87: 8526-8530, (1990) and Svab et al., Proc. Natl. Acad. Sci. USA 90: 913-917 (1993) and in U.S. Patent No. 5,693,507.
[0138] [0138] When adequate numbers of cells are obtained containing the exogenous polynucleic acid molecule encoding polypeptides of the present invention, the cells can be grown and then regenerated in whole plants. “Regeneration” refers to the process of growing a plant from a plant cell (for example, protoplasts or plant explants). Such regeneration techniques depend on the manipulation of certain phytohormones in a tissue culture growth medium, typically depending on a biocide and / or herbicide marker that has been introduced in conjunction with the desired nucleotide sequences. The choice of methodology for the regeneration stage is not critical. See, for example, Ammirato et al., “Handbook of Plant Cell Culture - Crop Species.” Macmillan Publ. Co. (1984); Shimamoto et al., Nature 338: 274-276 (1989); Fromm, UCLA Symposium on Molecular Strategies for Crop Improvement, April 16-22, 1990. Keystone, Colo. (nineteen ninety); Vasil et al., Bio / Technology 8: 429-434 (1990); Vasil et al.,
[0139] [0139] The development or regeneration of transgenic plants containing the exogenous polynucleic acid molecule encoding a polypeptide of interest is well known in the art. Preferably, the regenerated plants are self-pollinated in order to provide homozygous transgenic plants, as discussed above. Otherwise, pollen obtained from regenerated plants is crossed with plants grown from seeds of agronomically important strains. Conversely, pollen from plants of these important strains is used to pollinate regenerated plants.
[0140] [0140] The present invention provides disease resistant soybean plants and germ plasmas. A disease resistant soybean plant or germplasm can be produced by any method by which an R gene is introduced into the soybean plant or germline plasma, including, but not limited to, transformation, transformation or fusion with protoplasts, a haploid technique double, embryo rescue, gene editing and / or any other nucleic acid transfer system.
[0141] [0141] In some embodiments, the soybean germ or plasma comprises a variety of non-naturally occurring soybeans. In some embodiments, the soybean germ or plasma is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99 % or 100% identical to that of an elite soybean variety.
[0142] [0142] The disease resistant soybean plant or germplasm may be the progeny of a cross between an elite variety of soy and a variety of soy that comprises an R gene for improved disease tolerance (eg, FAS), where the R gene is selected from the group consisting of genes encoding a protein having a CNL or TNLW motif of the R gene or a gene having between 70-100% homology to any of SEQ ID NOs: 6, O, 12, 15, 18, 21, 24, 27 or 30.
[0143] [0143] The disease resistant soybean plant or germplasm may be the progeny of an introgression in which the recurrent parent is an elite soybean variety and the donor comprises an R gene associated with improved disease tolerance and / or resistance, wherein the donor has a gene that encodes a protein having a CNL or TNLW motif of the R gene or a gene having between 70-100% homology with any of SEQ ID NOs: 6, 9, 12, 15, 18, 21 , 24, 27 or 30.
[0144] [0144] The disease-resistant soybean plant or germplasm may be the progeny of a cross between a first elite soybean variety (for example, a test strain) and the progeny of a cross between a second soybean variety of elite (for example, a recurring parent) and a soybean variety that comprises an R gene.
[0145] [0145] A plant and the disease resistant soybean germplasm of the present invention may comprise one or R genes of the present invention (for example, any of SEQ ID NOs: 6, 9, 12,15, 18, 21, 24 , 27 or 30). Disease-Resistant Soybeans
[0146] [0146] The present invention provides disease-resistant soy seeds. As discussed above, the methods of the present invention can be used to identify producing and / or selecting a disease resistant soybean seed. In addition to the methods described above, a disease resistant soybean can be produced by any method by which an R gene is introduced into the soybean seed, including, but not limited to, transformation, transformation or fusion with protoplasts, a technique double haploid, embryo rescue, genetic editing (for example, CRISPR or TALEN or MegaNucleases) and / or by any other nucleic acid transfer system.
[0147] [0147] In some embodiments, disease-resistant soy seed comprises a variety of non-naturally occurring soy. In some embodiments, soybean seed is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100 % identical to that of an elite soybean variety.
[0148] [0148] The disease resistant soybean seed can be produced by an identified disease resistant soybean plant, produced or selected by the methods of the present invention.
[0149] [0149] A disease resistant soybean seed of the present invention can comprise, be selected or produced using one or more R genes of the present invention.
[0150] [0150] Additional embodiments of the invention include the following: EXAMPLES
[0151] [0151] The following examples are not intended to be a detailed catalog of all the different ways in which the present invention can be implemented or of all the features that can be added to the present invention. Those skilled in the art will appreciate that numerous variations and additions can be made to the various modalities without departing from the present invention. Consequently, the following descriptions are intended to illustrate some particular embodiments of the invention and not to exhaustively specify all of its permutations, combinations and variations.
[0152] [0152] Multiple strains of wild Glycine (Glycine tomentella) were evaluated for resistance to FAS against sixteen rust strains collected across a diverse range of environments. Rust data were generated using isolates derived from a single USDA-ARS pustule (FL Q09, FL Q12, LABR13, FLQ11) and field populations (FL Q15, FLQ16, RTP1, RTP2, Vero, BRO1, BRO2 and BRO3) , the analysis was carried out in confined facilities. Of the Glycine tomentella strains screened for FAS resistance, the following Glycine tomentella strains exhibited broad resistance against all tested FAS strains: PI441001, PI483224, PI583970, PI446958, PI499939, PI505220, PI499933, PI441008, PIS5O5256.
[0153] [0153] Each strain of Glycine tomentella was evaluated over a multi-day infection regimen and classified at various times using a Tferrugen classification scale based on modified Burdon and Speer clusters, TAG, 1984 (see FIG 6) . Each accession of Glycine tomentella was analyzed> 2 times with 4 plants each time using a large diversified panel of rust isolates. Example 2 Mining Alleles & Associations to FAS Loci from PI441001, PI441008, PI446958, PI583970 or PI483224
[0154] [0154] Resistant paternal strains (i.e., PI441001, PI441008, PI446958, PI583970 and PI483224) were crossed with a susceptible strain of Glycine tomentella and F1 plants were generated (See Table 2). Fl plants were self-fertilized to generate F2 seed. The F2 seed was collected from the self-fertilized F1 plant. About 200 F2 seeds were sown and leaf tissue from each plant was collected for genotyping studies. Each strain was inoculated with Phakopsora pachyrhizi to determine the resistance / susceptible phenotype of each individual F2. Tissue of 50 resistant F2s and 50 susceptible F2s was combined in separate meetings and genomic DNA was prepared from each meeting. Illumina sequencing libraries were prepared from DNA for each of the meetings and each library was sequenced in two 2x100 bp TIllumina HiSeg2000 ends. The average yield per sample was 383 million pairs of readings, which equals 77 gigabases of sequences per library. Sequence readings were trimmed to remove bases with PHRED quality scores <15.
[0155] [0155] The trimmed readings for quality were aligned with the reference genomic sequence of PI441001, PI441008, PI583970, and PI483224 using GSNAP (WU and NACU 2010) as paired end fragments. When it was not possible to align a pair of readings together, they were treated as singletons for alignment. The readings were used in subsequent analyzes when mapping in a unique way with the reference (<2 faulty matches every 36 bp and less than 5 bases for all 75 bp as tails).
[0156] [0156] SNP were filtered before the BSA analysis based on the reading depth, with SNP having between 40 and 200x of reading depth being retained. A Chi-square test was used to select SNP with significantly different reading counts between the two alleles at the two meetings. An empirical Bayesian approach (LIU et al. 2012) was used to estimate the conditioned probability that there would be no recombination between each SNP marker and the causal locus in the resistant meeting and in the susceptible meeting. The probability of the link between the SNP and the causal gene is the geometric mean of these two conditioned probabilities. It was found that about 1000 SNP had possible link to the target locus. A subset of these putatively linked SNPs was used to finely map the locus using phenotyped F2 individuals. See references: LIU, S., C.- T. YEH, H. M. TANG, D. NETTLETON AND P. S. SCHNABLE, 2012 "Gene Mapping via Bulked Segregant RNA-Seg (BSR-Seq)". PLoS ONE 7: e36406 & Wu, T. D., and S. Nacu, 2010 "Fast and SNP-tolerant detection of complex variants and splicing in short reads". Bioinformatics 26: 873-881.
[0157] [0157] TABLE 2: Intersections of Plants and Type of Study
[0158] [0158] 1. Lab Data2Bio LLC Methodology (Ames, Iowa) in PI441001 for Analysis by Tetraploid Soy gBSA-Segq.
[0159] [0159] The discovery of chromosomes for causal loci in the tetraploid soy population
[0160] [0160] PI441001 using Genomic Segregant Analysis technology in Volume
[0161] [0161] (gBSA) of Data2Bio. It has been theorized that resistance to FAS is controlled by a single dominant allele. Four libraries were generated from DNA samples extracted from two meetings of susceptible tissue and two meetings of resistant tissue. These meetings were then sequenced in eight (8) 2x100 bp Illumina HiSeg2000 Paired Ends (PE) paths. A summary of the reference genomes used for subsequent analyzes, processing raw data readings for trimming for quality, alignment, SNP discovery and SNP impact is shown in Figures 1-5 for the population
[0162] [0162] 2. Lab Data2Bio LLC Methodology (Ames, Iowa) in PI583970 for Analysis by Tetraploid Soy gBSA-Segq
[0163] [0163] The discovery of chromosomes for loci in the tetraploid soybean population
[0164] [0164] PI583970 using Genomic Segregant Analysis technology in Volume
[0165] [0165] (gBSA) of Data2Bio. Two libraries were created from RNA samples extracted from a collection of susceptible tissues and a collection of RNA from resistant tissues. After several filtration steps, 59,014 informational SNPs were identified in the PI583970 genome that were significantly associated with resistance to FAS. A Bayesian approach was then used to calculate probabilities associated with the trait. Then a physical map of SNP associated with the trace in contigs was created. The grouping of these SNPs suggests that the resistance loci are located at or near support 0O00819F (see Figure 7; Support 001084F is SEQ ID NO: 4). The context strings associated with these SNPs have also been aligned with the public genome of Glycine max to create an understanding at the chromosomal level of the mapping interval. The chromosomal positions of the SNPs associated with the trace (resistance to FAS) were then plotted. Most of the SNPs on the 001084F support mapped and clustered in a small region of ChrO5 (see Figure 8). The data suggest that the loci responsible for FAS resistance map within or near the range of 0.11 to 0.30 Mpb on the 001084F support (Figure 9).
[0166] [0166] 3. Lab Data2Bio LLC Methodology (Ames, Iowa) in PI483224 for Analysis by Tetraploid Soy gBSA-Segq
[0167] [0167] The discovery of chromosomes for causal loci in the tetraploid soybean population
[0168] [0168] PI483224 using Volume Genomic Segregant Analysis technology
[0169] [0169] (gBSA) of Data2Bio. Two libraries were created from DNA samples extracted from a collection of susceptible tissues and a collection of resistant tissues (PI483224). After several filtration steps, 428,263 informational SNPs were identified in the PI483224 genome as being significantly associated with resistance to FAS. A Bayesian approach was then used to calculate probabilities associated with the trait. Then a physical map of SNP associated with the trace in contigs was created. The grouping of these SNPs indicates that the FAS resistance loci are located on or near the 002687F support (see Figure 10). The context strings associated with these SNPs have also been aligned with the public genome of Glycine max to create an understanding at the chromosomal level of the mapping interval. The chromosomal positions of the SNP associated with the trait (resistant to FAS) were plotted. Most of the SNPs on the 002687F support mapped to a small region of Chro5 (See Figure 11). The data indicates that the FAS loci can map within or near the 0.17 to 0.36 MB range on the 002687F holder (see Figure 12 and SEQ ID NO: 3). Example 3 Embryo Rescue & Introgression of R Gen Intervals in Glycine max Strains
[0170] [0170] Embryo rescue is performed (as described below) and chemical treatment is applied to induce chromosomal duplication in order to generate amphidiploid shoots. When amphidiploid plants are fertile, they will be used for backcrossing with Glycine max. It will be necessary for backcrossing with Glycine max and subsequent embryo rescue to be carried out over several generations to gradually eliminate the chromosomes of perennial Glycine tomentella, eventually resulting in an FAS-resistant Glycine max plant.
[0171] [0171] Wide crosses were performed using Syngenta Elite soybean lines (Glycine max) (RM 3.7 to 4.8). Elite soybean strains are used as females (pollen receptors) and multiple accessions of Glycine tomentella are used as males or pollen donors. The selection of flowers from the Glycine tomentella plant containing anthers at the appropriate stage of development is important. New flowers,
[0172] [0172] Harvesting: Broad cross pods are harvested at approximately 14 to 16 days after pollination. (Harvest dates in the literature suggest 19 to 21 days, however, the above method allows for shorter harvesting time and more robust pods). The pods are collected and counted according to the wide crossover combination to determine the success of the crossover. The average success of the cross over multiple soybean females and 5 different accessions of Glycine tomentella is approximately 40%. Broad cross pods can contain 1 to 3 seeds, but 2 seeds are usually present in each F1 pod. The methodology described above allows the harvesting of pods at 14 to 16 days after pollination, -5 days earlier than described in the literature.
[0173] [0173] Embryo rescue: Mowed pods are collected and brought back to the laboratory to be sterilized. The pods are first rinsed with 70% EtoH for 2 to 3 minutes and then placed in 10% Clorox bleach for an additional 30 minutes on a shaking platform at approximately 130 RPM. Finally, the pods are rinsed multiple times with sterile water to remove any residual bleach. Embryo isolation can begin immediately after pod sterilization or pods can be stored at 4 ° C for up to 24 hours before embryo isolation. The sterile pods are then taken to a laminar flow hood where the embryos can be rescued. Individual pods are placed in a sterile Petri dish and opened using a scalpel and forceps. An incision is made along the length of the pod of the broad cross away from the seed. The pod can then be easily opened to expose the seed. Alternatively, two pairs of forceps can be used to separate the shell from the pod. Carefully remove the seed from the pod and place in a sterile Petri dish under a dissecting microscope. Very fine forceps are needed to isolate the embryo from the seed. With forceps in one hand, gently hold the side of the seed away from the embryo, with the hilum facing upwards.
[0174] [0174] Chromosomal duplication treatments: Colchicine or trifluralin can be used to induce chromosomal duplication. Ideally, wide-crossing embryos in the late (or larger) heart stage are chemically treated to induce chromosomal duplication at any time from immediately after isolation to 1 week post-isolation. The duplicating agent can be mixed in a solid or liquid medium and applied for several hours or even a few days. Trifluralin is used at a concentration of - 40 UM in solid or liquid media. Alternatively, colchicine is used at a concentration of 0.4 - 1 mg / mL in solid or liquid media. After chemical treatment, embryos are transferred to fresh embryo rescue medium.
[0175] [0175] Shoot regeneration: Developing embryos are transferred from rescue medium to germination medium, such as Soy ER GSMv2 (ie 3.2 g of mixture of Schenk and Hilderbrandt Basal salts, 1 g of Myo-inositol [CsH120s], 5 ml of Thiamine 1 mo / ml, 0.5 ml of pyridoxine 1 mg / ml, 10 g of sucrose [C12H22011], and 7.5 g of purified agar) for approximately 3 to 5 weeks in the light at 24 ºC. Alternatively, developing embryos can be transferred from rescue medium to elongation medium, such as Soy El O No TCV (ie, 4.3 g of MS Basal Salt Mix [MSPO1], 5 ml of MS 200X iron, 30 g of Sucrose [C12H22011], 1 g of MES [CsHI13N04S], 8 g of purified agar, 1 ml of vitamins B5 100X, 2 ml of glutamine 25 mg / ml, 0.50 ml of zeatin riboside, trans isomers 1 mg / ml, 0.1 ml of 1 mg / ml IAA, 0.2 ml of 5 mg / ml GA3, 1.5 ml of 100 mg / ml timentin, 0.3 ml of cefotaxime 250 mg / ml, O, 5 ml of vancomycin 100 mg / ml). Shoots can be kept in medium for approximately 3 to 5 weeks in light at 24ºC. Developing shoots can be transferred from media plates to PhytoCons containing germination medium or elongation for further shoot development. Established shoots having suitable roots are moved to soil.
[0176] [0176] Ploidy Analysis: Ploidy analysis is conducted using a flow cytometer. Leaf tissue for ploidy analysis is collected from small shoots in culture or after establishment in soil. The tissue is collected on dry ice and stored at -80 ºC until analysis, or collected on wet ice and analyzed on the same day. A sample size of 0.5 cm is sufficient. The samples are prepared according to the instructions in the Sysmex kit (Sysmex Inc., Kobe Japan). Each sample set contains an untreated F1 plant (untreated to induce chromosomal duplication) as a control. Example 4 FAS Resistance Trait Introgression
[0177] [0177] Amphidiploid strains generated from the wide cross (i.e., Glycine tomentella crossed with Glycine max) followed by embryo rescue as described in Example 3 were backcrossed multiple times with recurrent elite Glycine max strains. It is known in the art that multiple backcrosses are necessary to generate fertile hybrid strains, in particular, the literature suggests that a BC3 generation is necessary. In this case it was determined that additional backcrosses are needed, BC4 in the case of G. tomentella x G. max to generate fertile hybrid plants. F1 hybrid plants produced by the methods as described above were created from crosses - wide - comprising —PI441001, PI441008, PI446958, PI583970 and PI483224. F1 plants were then crossed as females with a male recurrent plant from
[0178] [0178] The additional genotyping of the various G. tomentella intervals led to the discovery of two genes that cause FAS resistance located on chromosome 5 within the disclosed intervals. A first type of gene encodes a TNLW motif of the R gene and is represented in SEQ ID NOs 6 and 30 located in PI441001 and PI583970, respectively. A second type of gene located in the discovered ranges encodes a CNL motif of the R gene and is represented in SEQ ID NOs 9, 12, 15, 18, 21, 24 and 27. It is contemplated that any of these genes or their counterparts can be used in a transgenic, gene editing or reproduction method using embryo rescue, as described above, to generate plants with increased resistance to FAS. Example 6 Construction of Vectors comprising R Genes
[0179] [0179] Constructs were generated comprising each of the R genes described in Example 5 above.
[0180] [0180] a) Vector construction for Gene R comprising SEQ ID NO: 6
[0181] [0181] Vector type: Binary Vector
[0182] [0182] Construct size (bp): 30,982
[0183] [0183] Functional description: A binary vector for transformation of soy with ALS selection, containing gGtoRG1- 01, a candidate gene for resistance to soybean rust that encodes a protein containing Toll / Interleukin-l1 receptor (TIR) domains, site nucleotide binding (NBS), leucine-rich repeat (LRR) and synthetic WKRY to Glyma.05G165800 (Soy william82 v2).
[0184] [0184] Cloning methods: GenScript synthesized RG1 as four fragments RG1-PartI, -ParteII, -ParteIII and -ParteIV [U9490B] 270-1 (23950), U9490BJ270-2 (23952), U9490BJ270-3 (23953) and U9490BJ270 -4 (23954)]. The first and last 2 fragments were cloned into the bridge vector 21177 using SanDI / ScaI, ScaI / RsrII, respectively to obtain intermediates 21177-ParteIl + II and 21177 Part-III + IV. Then, PartI + II (SanDI / Scal), PartIII + IV (ScaI / RsrII) in the two intermediaries were all cloned in 22296 at once through a three-way link at the SanDI site in
[0185] [0185] The strings used include SEQ ID NO. 6 (coding sequence), SEQ ID NO. 7 (promoter) and SEQ ID NO. 8 (terminator). SEQ ID NO: 6, encodes the protein of SEQ ID NO: 47.
[0186] [0186] b) Vector Construction for Gene R comprising SEQ ID NO: 9
[0187] [0187] Vector type: Binary vector
[0188] [0188] Construct size (bp): 17,713
[0189] [0189] Functional description: A binary vector for the transformation of soybeans with the ALS selection containing a candidate gene for soybean rust resistance that encodes a protein containing the coiled spiral (CC) domains, nucleotide binding site (NBS) and leucine-rich repeat (LRR). the gene is synthetic to Glyma.05G165600 (Soy william82 v2).
[0190] [0190] Cloning methods: GenScript synthesized RG2 as two fragments PartIl (SanDI / SacI, U1935CD120-1,24076) and PartII (SacI / RsrII, U1935CD120-2, 24077) and linked to 22296 in SanDI. The positive clone was confirmed by digestion with AlwW44I / EcoRI and by sequencing along the cloning junctions (SYNO4455: 151-153).
[0191] [0191] The strings used include SEQ ID NO. 9 (coding sequence), SEQ ID NO. 10 (promoter) and SEQ ID NO. 11 (terminator). SEQ ID NO: 9, encodes the protein of SEQ ID NO: 48.
[0192] [0192] c) Vector Construction for Gene R comprising SEQ ID NO: 12
[0193] [0193] Vector type: Binary Vector
[0194] [0194] Functional description A binary vector for glyphosate selection soybean (EPSPS) containing a gene for soybean rust resistance from G. tomentella PI583970 that encodes a protein containing the coiled spiral (CC) domains, site of nucleotide binding (NBS) and leucine rich repeat (LRR) expressed with the G. tomentella native promoter and terminator (genomic DNA). The gene is synthetic to Glyma.O5G165600 (Soy william82 v2).
[0195] [0195] The strings used include SEQ ID NO. 12 (coding sequence), SEQ ID NO. 13 (promoter) and SEQ ID NO. 14 (terminator). SEQ ID NO. 12, encodes the protein of SEQ ID NO: 42.
[0196] [0196] d) Vector Construction for Gene R comprising SEQ ID NO: 15
[0197] [0197] Vector type: Binary Vector
[0198] [0198] Construct size (bp): 14,706
[0199] [0199] Functional description: A binary vector for transformation of soy with glyphosate selection (EPSPS), containing a candidate gene for soybean rust resistance from Glycine tomentella (PI583970), cGtoRG13-01, which encodes a protein containing the spiral domains rolled (CC), nucleotide binding site (NBS) and leucine-rich repeat (LRR) and directed by a soybean GmUbi promoter and Arabidopsis terminator plus a soybean kKkozak. The candidate gene is synthetic to Glyma.O05G165600 (Soy william82 v2).
[0200] [0200] Cloning methods: Mutated site U3962BF220-1 (prGmUBI1) so that the promoter fragment can be cut using SanDI and BamHI (U1466CH300 6 by Genscript). CGtoRG13 synthesized as a BamHI-SacI fragment (G6S19921, UV1466CH300 6 by Genscript), cut the fragment. Three-way link no 23899 between the SanDI and SacI sites to obtain the New VC21449 (SYNO3277: 183). The construct was verified by digestion using SalIl and ApalIl, as well as by HincII alone, followed by sequencing (SYNO03277: 184-185).
[0201] [0201] The strings used include SEQ ID NO. 15 (coding sequence), SEQ ID NO. 16 (Ubiquitin 1 native promoter preGmUbil1-01 of soybean; Accession D1I6248.1) and SEQ ID NO. 8 (Terminator tAtUBQO3-02 A at 328 bp tAtUbg3-01 (Arabidopsis Uba3 3'-UTR). SEQ ID NO: 15, encodes the protein of SEQ ID NO: 43.
[0202] [0202] e) Vector Construction for Gene R comprising SEQ ID NO: 18
[0203] [0203] Vector type: Binary Vector
[0204] [0204] Functional description A binary vector for the transformation of soybean with glyphosate selection (EPSPS) containing a candidate gene for resistance to soybean rust from G. tomentella PI583970 that encodes a protein containing the coiled spiral (CC) domains, site of nucleotide binding (NBS) and leucine rich repeat (LRR) expressed with the Medicago truncatula promoter and the Arabidopsis terminator plus a soybean Kkozak. The gene is synthetic to Glyma.05G165600 (Soy william82 v2).
[0205] [0205] Cloning Instructions See VC21449 ... replace prGmUbil1-01 with the prMt51186-03 promoter. Connect as cassette of the SanDI / RsrII gene to the SanDI site of
[0206] [0206] The strings used include SEQ ID NO. 18 (coding sequence), SEQ ID NO. 19 (promoter prMt51186-03. The promoter of the Medicago truncatula gene identified by the probe GeneChip ID Mtr.51186.1.S1) and SEQ ID NO. 20 (UTR terminator of Ubiquitin from Arabidopsis). SEQ ID NO: 18, encodes the protein of SEQ ID NO: 49.
[0207] [0207] f) Vector Construction for Gene R comprising SEQ ID NO: 21
[0208] [0208] Vector type: Binary vector
[0209] [0209] Construct size (bp): 16,801
[0210] [0210] Functional description: Binary vector for transformation of soybean with selection of Glyphosate (cmEPSPS), containing a genomic fragment derived from Glycine tomentella (PI446958), gGtoRG11-01, to express a soybean rust resistance gene that encodes a protein containing a coiled spiral domain, nucleotide binding site and leucine rich repeat (CC-NBS-
[0211] [0211] Cloning methods: U8867CG170-1 digested with SanDI / SacI to obtain the RGl1-ParteIl fragment (4899 bp), U8867CG170-2 digested with SacI / RsrII / Eaml105I to obtain the RGll-ParteIIT fragment (2609 bp), connect these two fragments at 20660 at the SanDI site. The resulting VC21209 construct was confirmed by digestion with AlwW441 / EcoRI / Bsp1l191I and by sequencing along the cloning junctions. (SYNO4456: 102-105). The resulting construct is 24160.
[0212] [0212] The strings used include SEQ ID NO. 21 (coding sequence), SEQ ID NO. 22 (promoter) and SEQ ID NO. 23 (terminator). SEQ ID NO: 21, encodes the protein of SEQ ID NO: 44.
[0213] [0213] g) Vector Construction for Gene R comprising SEQ ID NO: 24
[0214] [0214] Vector type: Binary Vector
[0215] [0215] Functional Description Binary vector for soybean transformation to express the soybean rust resistance gene, cGtoRG11Ver221F, which encodes a protein containing a coiled spiral domain, nucleotide binding site and leucine-rich repeat (CC-NBS -LRR). This gene is synthetic to Glyma.O5G65600 (Soy williams82 v2) and is derived from the contig allele 221F of Glycine tomentella (PI446958), gGtoRG11-01. The expression is directed by the promoter Ubil of the soybean and the terminator Ubg3 of Arabidopsis. The vector uses the selection of Glyphosate (cmEPSPS).
[0216] [0216] Cloning Instructions Digest the synthetic coding sequence (remove the internal SacI site) with BamHI / SacI and link to the BamHI / SacI site of binary vector 24171 to replace the existing CNL gene.
[0217] [0217] Note: promoter and terminator are the same as those of construct 24171
[0218] [0218] The strings used include SEQ ID NO. 24 (coding sequence), SEQ ID NO. 25 (promoter) and SEQ ID NO. 26 (terminator). SEQ ID NO: 24, encodes the protein of SEQ ID NO: 45.
[0219] [0219] h) Vector Construction for Gene R comprising SEQ ID NO: 27
[0220] [0220] Vector type: Binary Vector
[0221] [0221] CNL allelic found in construct 24160. Identified by high-affinity PCR amplification from genomic DNA PI446958. Notebook Ref. SYO4474: 53
[0222] [0222] Direct Initiator: GGATTATGTTTATATTCGAGTACATGCTATTGC
[0223] [0223] Reverse initiator: GGGATTCAAAGGCATCTTAGATTAGTCAAACATCC
[0224] [0224] Temp. melting point: 98 ºC
[0225] [0225] Temp. Pairing: 58 ºC
[0226] [0226] Temp. elongation: 72 ºC
[0227] [0227] 35 cycles
[0228] [0228] The PCR product was purified by agarose gel electrophoresis and subcloned into TOPO clone vectors (PCR Blunt). The individual colonies of E. coli were isolated in the medium of selection of Kanamycin-LB. Plasmid preparations were prepared and insertions sequenced.
[0229] [0229] Functional Description Binary vector for soybean transformation to express a soybean rust resistance candidate gene, cGtoRG11VerlF, which encodes a protein containing a coiled spiral domain, nucleotide binding site and leucine-rich repeat (CC-NBS -LRR). This gene is synthetic to Glyma.O05G65600 (Soy williams82 v2) and is derived from the contig allele 1F of Glycine tomentella (PI446958), similar to gGtoRG11-01. The expression is directed by the promoter Ubil of the soybean and the terminator Ubg3 of Arabidopsis. The vector uses the selection of Glyphosate (cmEPSPS).
[0230] [0230] The strings used include SEQ ID NO. 27 (coding sequence), SEQ ID NO. 28 (promoter) and SEQ ID NO. 29 (terminator). SEQ ID NO: 27, encodes the protein of SEQ ID NO: 46.
[0231] [0231] i) Vector Construction for Gene R comprising SEQ ID NO: 30
[0232] [0232] Vector type: Binary Vector
[0233] [0233] Functional description: A binary vector for soybean transformation with ALS selection, containing a candidate soybean rust resistance gene that encodes a protein containing some Toll-like receptor domains
[0234] [0234] Cloning methods: GenScript synthesized RG5 as four fragments RG5-PartelI, -ParteII, -ParteIII and -ParteIV [U9490B] 270-5 (23955), U9490BJ270-6 (23956), U9490BJ270-7 (23957) and U9490BJ270 -8 (23958)]. The first 3 fragments were cloned into the bridge vector 21177 as SanDI + Kpn21I, respectively to obtain intermediate 21177- PartI + II + III. Then, PartI + II + III (SanDI / Kpn21) of this intermediate vector and PartIlV (Kpn2I / RsrII) were all cloned at 22296 at once through a three-way link at the 22296 SanDI site. The positive clone was confirmed by digestion with NcoI / HindIII and by sequencing along the cloning junctions (SYNO4455: 65-78).
[0235] [0235] The strings used include SEQ ID NO. 30 (coding sequence), SEQ ID NO. 31 (promoter) and SEQ ID NO. 32 (terminator). SEQ ID NO: 30, encodes the protein of SEQ ID NO: 50. Example 7 Validation of R Genes against FAS
[0236] [0236] Validation of the molecular assay using transcripts of fungal b-tubulin as a measure of resistance
[0237] [0237] In our phenotyping work, we use symptom assessment and molecular assays to classify rust resistance or susceptibility. The symptom assessment is a modified version of a Burdon and Speer rust rating scale, TAG, 1984. The molecular assay is based on a fungal housekeeping gene, b-tubulin, identified by a Syngenta scientist , the b-tubulin probe targets a specific region in soybean rust, but not in other pathogens or plant species. In addition, we validate this molecular assay together with symptomatic phenotypic observations, as shown in Figure 9 and Figure 1. Figure 9, from left to right, top to bottom, illustrates complete resistance (Rppl lineage), some lesions without sporulation (Rpp5 lines), many lesions with small sporulations (Rpp6 line), many lesions with some Tan lesions plus sporulations (Rpp2 lines), for many Tan lesions with abundant sporulations (Rpp4, Rpplb and Jack). As the rust used in this example is virulent in Rpp4 and Rpplb, these 2 strains show susceptibility as severe as the susceptible control, Jack.
[0238] [0238] Consistent with these observations, measurements made with fungal b-tubulin transcripts shown in the graph in Figure 1, from left to right, without transcript detection (complete resistance, Rppl1 lineage), level of transcripts hardly detectable (some lesions without sporulation, lines Rpp5 and Rpp6), low level of transcripts (many lesions with small sporulations, line Rpp6), intermediate level of transcripts (many lesions with some lesions / Tan sporulations, line Rpp2), high level of transcripts (many Tan lesions with profuse sporulations, strains Rpp4, Rpplb and Jack (CK)).
[0239] [0239] From these data sets, we show that a molecular assay using fungal b-tubulin or other constitutive genes is as reliable and indicative as the phenotypic symptomatic classifications and provides a higher resolution than the phenotypic classifications based on symptoms.
[0240] [0240] Validation of the transient leaf gene expression system using the known soybean rust R gene
[0241] [0241] A transient split-leaf test has been developed to validate rust resistance. This was done using a susceptible soybean leaf, or its wild relatives, and transiently expressing a GUS control vector on one side of the leaf and transiently expressing a vector containing an R gene on the other side of the leaf (ie, the median rib of the leaf). leaf being the divider in addition the control and experimental vectors are similar, except for the respective CDS (GUS or R gene)) After 2-3 days of infiltration, the leaves were sprayed with rust. About 10 to 17 days, the infiltrated leaves were selected and cut in half by the middle vein divider. The left side (top view) of each leaf with only the infiltrated area was cut and filled in 1 well in a 96-well block, identified as the left construct-1. The right side (top view) of the leaf was cut and filled in one well, the right half leaf filled the other, 8 pairs of wells per construct. In each experiment, the right side of the leaves was infiltrated with a construct containing GUS, while the left side was infiltrated with the constructs of interest. For GUS control, it means that both sides of the sheet were infiltrated with constructs containing GUS. All of them were analyzed to determine the fungal biomass using the quantitative polymerase chain reaction of fungal b-tubulin transcripts.
[0242] [0242] First, we validate the system with GUS (in construct 17282) as a negative control and CcRppl (R gene of soybean rust from Cajanus cajan in construct 23677). CcRppl showed almost 100% disease control in stable transgenic soybeans, when in the homozygous state and the protein level reaches a certain level (Kawashima et al., 2016 for resistance to the rust of angola pea soy). It is appropriate to be used as a positive control for system validation. The GUS and CcRppl constructs were co-filtered with the 18515 construct, a CFP construct to determine the efficiency of the transformation.
[0243] [0243] In quantitative reverse transcription polymerase chain reactions, three ways to process data using b-tubulin and fungal CFP transcripts. CFP can be used as a measure of transformation efficiency. In this configuration, the formula in Figure 2 was used.
[0244] [0244] As shown in Figure 3, the construct containing CcRppl has significantly less accumulation of normalized fungal biomass compared to the construct containing 95% confidence GUS, while the GUS control is not significantly different from 1, which means that The amount of fungal biomass accumulated on both sides infiltrated with GUS is not statistically different. While the construct containing half leaves infiltrated with CcRppl produced a significantly lower amount compared to the side infiltrated with the construct containing GUS. This experiment was repeated once, and similar results were obtained. In all experiments, an elite Syngenta strain or Glycine canescens strain was used. From this experience, an individual with common skill in the technique could argue that other closely related soya or legume strains could also be used.
[0245] [0245] We also tested the system without CFP transformation efficiency control. In this experiment, we compared constructs containing GUS, CcRppl and CNL of 583970 (construct 24230). 0 24230 is derived from amplified genomic DNA using primers designed from contigs 819F containing binding to coiled spiral nucleotides and leucine rich (CNL) repeat. In this experiment, we test whether the control of the efficiency of the CFP transformation can be ignored or not. Since there is no CFP in this experiment, the formula in Figure 4 was used to process the transcription data for any construct.
[0246] [0246] As shown in Figure 5, CcRppl and 24230 (SEQ ID NO: X) showed efficacy in rust resistance when compared to negative GUS verification. But, surprisingly, 24230 seems more effective than CCcRppl. This may be due to the fact that the level of CcRpp1 expression is not high enough to confer total resistance, as occurs in stable transgenics. However, it reinforces the observation that the leaf expression of split leaves is sufficient to detect the resistance function.
[0247] [0247] We tested yet another GUS construct as a negative control. In this experiment, construct 21349 (GUS) and 24230 (R CNL gene from PI 583970, SEQ ID NO: X) were used. As shown in Figure 6, two sets of samples derived from 24230 are lower in fungal biomass than 21349. In this scenario, we compared the fungal b-tubulin on the side infiltrated with the construct of interest directly with the other side infiltrated with the construct containing GUS without normalization, except that the value of the readings of the transcripts was processed by Log2. Again, the side infiltrated with the 24230 construct showed significantly less fungal biomass than the side infiltrated with the construct containing GUS.
[0248] [0248] We also tested another construct, 23969, along with the GUS check. 23969 contains another candidate gene in the chromosome 5 range, which encodes the Tle interleukin nucleotide bond and the leucine-rich repeating protein with the WRKY (TNLW) domain. This resistance conferred by the gene in this construct is evident, as indicated by a significantly lower level of fungal biomass than the negative GUS control (Figure 6).
[0249] [0249] Stable Transformation with FAS Candidate Gene Vectors
[0250] [0250] Agrobacterium tumefaciens strains containing the individual binary vector with the selectable marker gene PAT, ALS or EPSPS and one or more of the soybean rust resistance candidate genes were transformed into explants prepared from soaked soybean seeds, as prepared by the method described here (Khan 2004, US Patent Application Publication 20040034889). The soybean seeds were selected from Jack, Williams 82 or an elite variety from Syngenta, such as O6KG 218440. Figures 7 and 8 show data for stable transformers in phase T1 (SEQ ID NO: 21) and TO (SEQ ID NO : 27).
[0251] [0251] From the data set above, we have reason to believe that the two genes in the range, CNL and TNLW, confer resistance to soybean rust. It would be reasonable to stack them to examine the resistance conferred by the two genes together, stronger resistance could be expected.
[0252] [0252] The above examples clearly illustrate the advantages of the invention. Although the present invention has been described with reference to specific details of certain modalities, it is not intended that such details should be considered as limitations on the scope of the invention, unless and to the extent that they are included in the accompanying claims.
[0253] [0253] Throughout this application, several patents, patent publications and different patent publications are referred to. The disclosures of these patents, patent publications and different patent publications, in their entirety, are incorporated by reference here in this application to more fully describe the state of the art to which this invention belongs.
[0254] [0254] From the data set above, we have reason to believe that the two genes in the range, CNL and TNLW, confer resistance to soybean rust. It would be reasonable to stack them to examine the resistance conferred by the two genes together, stronger resistance could be expected.
[0255] [0255] The above examples clearly illustrate the advantages of the invention. Although the present invention has been described with reference to specific details of certain modalities, it is not intended that such details should be considered as limitations on the scope of the invention, unless and to the extent that they are included in the accompanying claims.
[0256] [0256] Throughout this application, several patents, patent publications and different patent publications are referred to. The disclosures of these patents, patent publications and different patent publications, in their entirety, are incorporated by reference here in this application to more fully describe the state of the art to which this invention belongs.

权利要求:
Claims (30)
[1]
1. Vector comprising an R gene encoding a CNL or TNLWR genetic motif, characterized by the fact that said R gene is derived from Glycine tomentella (for example, from any of the publicly available access lines PI441001, PI483224, PI583970, PI446958 , PI499939, PI505220, PI499933, PI441008, PI5O5256 or PI446961).
[2]
2. Vector comprising an R gene operably linked to a promoter, characterized by the fact that the R gene is a sequence of nucleotides having between 70% to 100% sequence identity with any of SEQ ID NOs: 6, 9, 12 , 15, 18, 21, 24, 27 or 30.
[3]
3. Vector comprising an R gene operably linked to a promoter, characterized by the fact that the R gene encodes a protein having at least 90% sequence identity with any of SEQ ID NOs: 42, 43, 44, 45, 46 , 47, 48, 49 or 50.
[4]
4. Vector according to any one of claims 1, 2 and 3, characterized by the fact that the promoter comprises any of SEQ ID NOs: 7, 10, 13, 16, 19, 22, 25, 28 or 31.
[5]
5. Plant cell and / or plant characterized by the fact that it comprises any of the vectors, as defined in any one of claims 1, 2, 3 and 4,
[6]
6. Plant cell, according to claim 5, characterized by the fact that the plant and / or plant cell is soybean.
[7]
7. Method of preparing a pathogen-resistant soy plant, characterized by the fact that it comprises the steps of: a. contacting a recipient plant cell with the vector, as defined in any one of claims 1, 2, 3 and 4, wherein said vector is incorporated into the genome of the recipient plant cell; B. regenerating the recipient plant cell in a plant; and C. test the plant for resistance to a soybean pathogen.
[8]
8. Method according to claim 9, characterized in that the vector comprises a nucleotide sequence that encodes a protein sequence selected from the group consisting of SEQ ID NOs: 42, 43, 44, 45, 46, 47, 48, 49 or 50.
[9]
9, Method according to claim 9, characterized by the fact that the vector comprises a sequence of polynucleotides selected from the group consisting of: SEQ ID NOs: 6, 9, 12, 15, 18, 21, 24, 27 or 30 .
[10]
10. Pathogen resistant soybean plant characterized by the fact that it is obtained by the method, as defined in any one of claims 7, 8 and 9.
[11]
11. Elite soybean plant characterized by the fact that it comprises a protein sequence selected from the group consisting of: SEQ ID NOs. 42, 43, 44, 45, 46, 47, 48, 49 or 50.
[12]
12. Soy plant, according to claim 11, characterized by the fact that the selected sequence was introduced transgenically.
[13]
13. Elite soybean plant according to any of claims 10, 11 and 12, characterized by the fact that the soybean plant has increased resistance to any of the following: soybean cyst-forming nematode, bacterial pustule, nematode of root galls, cercosporiosis, Phytopthora, brown stem rot, nematode, Asian Soybean Rust, soot, Golovinomyces cichoracearum, Erysiphe cichoracearum, Blumeria graminis, Podosphaera xanthii, Sphaerotheca fuligisea, Pyramid, pyramid, Pyramid, Pyramid oryzae, Magnaporthe grisea, Rhizoctonia solani, Phytophthoraoyae, Schizaphis graminum, Bemisia tabaci, Rhopalosiphum —maidis, Deroceras reticulatum, Diatraea saccharalis, Schizaphis graminum or Myzus persicae.
[14]
14. Elite soy plant according to any of claims 10, 11, 12 and 13, characterized by the fact that the plant is resistant to Asian Soybean Rust.
[15]
15. Method for controlling Asian Soybean Rust in a field, characterized by the fact that it comprises the stage of planting the seed of any of the plants, as defined in any of claims 10, 11, 12, 13 and 14.
[16]
16. Nucleic acid molecule comprising a polynucleotide operably linked to a heterologous promoter, characterized by the fact that said polynucleotide encodes a polypeptide selected from the group consisting of: a. SEQ ID NOs. 42, 43, 44, 45, 46, 47, 48, 49 or 50; or b. Polypeptides having at least 90% identity with at least one polypeptide from (a).
[17]
17. Nucleic acid molecule according to claim 16, characterized by the fact that the heterologous promoter is a promoter expressible in plants.
[18]
18. Vector characterized by the fact that it comprises the nucleic acid molecule, as defined in any of claims 16 and 17.
[19]
19. Transgenic cell characterized by the fact that it comprises the nucleic acid, as defined in any of claims 16 and 17, or the vector, according to claim 18.
[20]
20. Transgenic cell according to claim 19, characterized by the fact that the cell is a transgenic plant cell.
[21]
21. The transgenic plant cell according to claim 20, characterized by the fact that the plant cell is: a. a monocot cell, optionally a barley cell, a corn cell, an oat cell, a rice cell, a sorghum cell, a sugarcane cell or a wheat cell; or b. a dicotyledonous cell, optionally a soybean cell, a sunflower cell, a tomato cell, a cabbage culture cell, a cotton cell, a sugar beet cell or a tobacco cell.
[22]
22. The transgenic plant cell according to claim 21, characterized by the fact that the plant cell is a soybean cell.
[23]
23. Transgenic plant characterized by the fact that it comprises the transgenic plant cell, as defined in any of claims 21 and 22.
[24]
24. Transgenic seed characterized by the fact that it is from the transgenic plant, as defined in the claim
23.
[25]
25. Collected product characterized by the fact that it is derived from the transgenic plant, as defined in claim 23, or from transgenic seed, as defined in claim 24.
[26]
26. Processed product derived from the collected product, as defined in claim 25, characterized by the fact that the processed product is a flour, bran, oil, starch or a product derived from any of the foregoing.
[27]
27. Method of producing a transgenic plant with increased resistance to a soybean pathogen and comprising an R gene, the method characterized by the fact that it comprises introducing the nucleic acid molecule into a plant, as defined in any one of claims 16 and 17, or the vector, as defined in claim 18, in which the R gene is expressed in the plant, thereby producing a transgenic plant with increased resistance to a soybean pathogen.
[28]
28. Method according to claim 27, characterized by the fact that the introduction step comprises:
i. transforming a plant cell with the nucleic acid molecule or vector and regenerating a transgenic plant; or ii. crossing a first plant comprising the nucleic acid molecule or vector with a second plant.
[29]
29. Method according to any one of claims 27 and 28, characterized in that the method additionally comprises obtaining a progeny plant for one or more generations from the transgenic plant, wherein the progeny plant comprises the molecule of nucleic acid or the vector and has increased resistance to a soybean pathogen.
[30]
30. Method for testing resistance to FAS characterized by the fact that it comprises: a. obtaining a leaf from a variety of soybeans or a leaf from a related wild Glycine plant; B. transiently expressing a GUS or other reporter gene control vector on one side of the leaf; ç. transiently expressing an R gene on the other side of the leaf; d. spray the leaves with FAS spores; and. after about 10 to 17 days, cut the leaves in half through the middle vein divider; and f. analyze each half of the leaf for fungal biomass.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112020010066A2|2020-11-03|new resistance genes associated with disease resistance in soybeans

---

ES2744675T3|2020-02-25|Corn Rƒ4 cytoplasmic male sterility restorer | gene, molecular markers and their use

---

AU2017366760A1|2019-05-16|Simultaneous gene editing and haploid induction

---

JP6389295B2|2018-09-12|Plant of the genus Cucurbita resistant to potyvirus

---

US20210040569A1|2021-02-11|Methods of identifying, selecting, and producing disease resistant crops

---

US20210230709A1|2021-07-29|Methods of identifying, selecting, and producing southern corn rust resistant crops

---

WO2013060136A1|2013-05-02|Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel

---

US11236346B2|2022-02-01|Diplospory gene

---

EA036149B1|2020-10-05|Genetic loci associated with increased fertility in maize

---

Matsui et al.2020|Genetic and genomic research for the development of an efficient breeding system in heterostylous self-incompatible common buckwheat |

---

WO2021022101A2|2021-02-04|Genetic loci associated with disease resistance in soybeans

---

JP2021511789A|2021-05-13|Spinach plants resistant to at least Peronospora farinosa races 8 and 10-16

---

WO2019062895A1|2019-04-04|Use of maize gene zmabcg20 in regulating crop male fertility and dna molecular markers associated with maize male fertility and use thereof

---

WO2014112875A1|2014-07-24|A new method to provide resistance to bacterial soft rot in plants

---

US20210388368A1|2021-12-16|Scaevola plants with radially symmetrical flowers

---

WO2021022022A1|2021-02-04|Novel resistance genes associated with disease resistance in soybeans

---

CA3143917A1|2021-02-04|Novel resistance genes associated with disease resistance in soybeans

---

WO2021260673A2|2021-12-30|Novel resistance genes associated with disease resistance in soybeans

---

JP2016523510A|2016-08-12|Brassica plants comprising mutant DA1 alleles

---

JP2021511063A|2021-05-06|Spinach plants resistant to at least Peronospora farinosa races 8, 9, 11, 13 and 16

---

Chahal2021|Evaluation of Phylogenetically Distant Baby Boom Genes for Their Ability to Induce Parthenogenesis in Rice

---

CA3138988A1|2020-12-03|Gene for parthenogenesis

---

CN113631722A|2021-11-09|Methods for identifying, selecting and producing southern corn rust resistant crops

---

WO2021211227A1|2021-10-21|Plant pathogen effector and disease resistance gene identification, compositions, and methods of use

---

Zhang2018|Identification and characterization of candidate genes for peach fruit shape

同族专利:

---

公开号 | 公开日

---

EP3714058A1|2020-09-30|

---

WO2019103918A1|2019-05-31|

---

CN111511920A|2020-08-07|

---

US20200354739A1|2020-11-12|

---

AR113896A1|2020-06-24|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US9029636B2|2008-02-05|2015-05-12|Monsanto Technology Llc|Isolated novel nucleic acid and protein molecules from soy and methods of using those molecules to generate transgenic plants with enhanced agronomic traits|

---

CN107873057A|2015-05-11|2018-04-03|双刃基金会|For shifting polynucleotides and method to Asian Soybean Rust resistance|WO2021022101A2|2019-07-31|2021-02-04|Syngenta Crop Protection Ag|Genetic loci associated with disease resistance in soybeans|

---

WO2021022026A2|2019-07-31|2021-02-04|Syngenta Crop Protection Ag|Genetic loci associated with disease resistance in soybeans|

---

WO2021022022A1|2019-08-01|2021-02-04|Syngenta Crop Protection Ag|Novel resistance genes associated with disease resistance in soybeans|

---

EP3701796A1|2019-08-08|2020-09-02|Bayer AG|Active compound combinations|

---

WO2021064075A1|2019-10-02|2021-04-08|Bayer Aktiengesellschaft|Active compound combinations comprising fatty acids|

---

WO2021097162A1|2019-11-13|2021-05-20|Bayer Cropscience Lp|Beneficial combinations with paenibacillus|

---

WO2021099271A1|2019-11-18|2021-05-27|Bayer Aktiengesellschaft|Active compound combinations comprising fatty acids|

---

EP3708565A1|2020-03-04|2020-09-16|Bayer AG|Pyrimidinyloxyphenylamidines and the use thereof as fungicides|

---

WO2021209490A1|2020-04-16|2021-10-21|Bayer Aktiengesellschaft|Cyclaminephenylaminoquinolines as fungicides|

---

WO2021224220A1|2020-05-06|2021-11-11|Bayer Aktiengesellschaft|Pyridine amides as fungicidal compounds|

---

WO2021228734A1|2020-05-12|2021-11-18|Bayer Aktiengesellschaft|Triazine and pyrimidine amides as fungicidal compounds|

---

WO2021233861A1|2020-05-19|2021-11-25|Bayer Aktiengesellschaft|Azabicyclicamides as fungicidal compounds|

---

WO2021245087A1|2020-06-04|2021-12-09|Bayer Aktiengesellschaft|Heterocyclyl pyrimidines and triazines as novel fungicides|

---

WO2021249995A1|2020-06-10|2021-12-16|Bayer Aktiengesellschaft|Azabicyclyl-substituted heterocycles as fungicides|

---

WO2021255071A1|2020-06-18|2021-12-23|Bayer Aktiengesellschaft|3--5,6-dihydro-4h-1,2,4-oxadiazine derivatives as fungicides for crop protection|

---

WO2021255118A1|2020-06-18|2021-12-23|Bayer Aktiengesellschaft|Composition for use in agriculture|

---

WO2021255089A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides|

---

WO2021255170A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazole pyrimidines as fungicides|

---

WO2021255091A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazoles and their derivatives as fungicides|

---

WO2021255169A1|2020-06-19|2021-12-23|Bayer Aktiengesellschaft|1,3,4-oxadiazole pyrimidines as fungicides|

---

EP3915971A4|2020-12-16|2021-12-01|Bayer Ag|Phenyl-sn-phenylamidines and the use thereof as fungicides|

法律状态:
2021-12-07| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201762589245P| true| 2017-11-21|2017-11-21|

---

US62/589,245|2017-11-21|

---

PCT/US2018/061411|WO2019103918A1|2017-11-21|2018-11-16|Novel resistance genes associated with disease resistance in soybeans|

---